Mention the effects of radioactivity on the environment

1 answer:

3 0

Just like in humans, radioactive material can damage plant tissues as well as inhibit growth. mutations are possible due to damage caused to the DNA. radioactive material in soil can prevent nutrient from being taken in by plants, causing it to be infertile.

You might be interested in

When making a salt water solution the salt is the

Paladinen [302]

Answer:

sodium chloride

3 0

2 years ago

Read 2 more answers

Ions are necessary to activate the binding sites on the actin filaments.

adoni [48]

Calcium is the answer

5 0

2 years ago

A moss-covered log is overturned by a hungry bear looking for insects to eat. The bear disturbs an ant colony, and some chipmunk

ValentinkaMS [17]

Answer:

C) They are part of a community

Explanation:

A community represents the sum total of populations of different species present together in an area or ecosystem. In a community, the organisms of these different species may benefit or harm each other and exhibit little or more interdependence. In the given example, beer, insects, ants, chipmunks represent the organisms of different species that are present together in a habitat. They interact with each other in various ways. For instance, the bear is a predator of insects.

5 0

2 years ago

Single Strand Binding Proteins are responsible for:

goblinko [34]

Answer:

C. keeping the strands separated during replication.

I think

Explanation:

3 0

1 year ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Mention the effects of radioactivity on the environment​

Mention the effects of radioactivity on the environment