1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sloan [31]
3 years ago
12

A question a critical reader might ask is

Biology
1 answer:
sergij07 [2.7K]3 years ago
3 0

Answer:

b. is the answer ..... btw hope you have a great fay

You might be interested in
Around 40% of cats with white fur and blue eyes are deaf. The gene responsible is pleiotropic. What does this mean?
Vesna [10]
The gene is responsible for the cat's hearing.
4 0
3 years ago
QUESTION 1 Two blue-eyed parents (recessive) will have 100% blue-eyed children. True False Save Answer QUESTION 2 Unless a paren
Paladinen [302]
1, true 
2,false
3, false
4,true 
5,false
5 0
3 years ago
Read 2 more answers
(PLEASE HELP !!!!!???!!)
Fed [463]

Answer:

idk if it's good..

Explanation:

The dark-colored mice arose in the population at location A by random mutation. ... advantage over light-colored mice in that environment. • Over time, dark-colored mice became more common at location B because more of their offspring survived. to reproduce and pass on their genes, including genes for fur color.

3 0
3 years ago
Studying material culture is important to anthropologists because:
lidiya [134]

It is important for anthropologists to have studying material culture because the objects that are being created and are being shaped by human beings are for them, has meaning behind it and has practices in which involves with the cultures.

4 0
3 years ago
he burrowing owl is found in dry, open areas such as grasslands, prairies, savannas, deserts, farmlands, golf courses, and other
Arturiano [62]

Hey there!

A Burrowing owl's habitat is destroyed which is due to human activities and will come under Artificial destruction via human influence and not due to a natural destruction like cyclones, High Richter scale earthquakes, hurricanes with extremely high knot speeds, etc. Instead I'll say because of which the population of the burrowing owl will obviously decrease because they're more adapted to "their previous environment" and most likely "wouldn't adapt to a new unfamiliar environment".

To break these contradictions down simply said "they're unaware of the rules, regulations, type of soil, type of trophic levels, number of predatory organisms, etc. this makes it pretty hard to move from their once said naturally provided nature-made habitat to the burrowing owl, which got lost due to habitat annihilation by human cause. Further making the owls to adapt and change their "NATURAL TRAITS" to make it "CUSTOM" because of which these aren't going to help them instead they'd go either extinct by moving to a newly known unfamiliar habitat rather than their naturally nature gifted habitation.

So Yeah, the correct option [after the question mark ends] to be the least likely outcome would've been  "the population of species of burrowing owl maybe increase as per arriving in a new habitat or introduced to newly made surroundings". This is "Highly and the most unlikely" or the "least likely predictable outcome" for burrowing owls. Introduction of species to newer habitats without any prior training, kills the species and it's progenies.

Hope this helps  you and gives you the detailed analysis for this query for burrowing owls!!!!



5 0
4 years ago
Read 2 more answers
Other questions:
  • Identify each adaptation as structural or behavioral adaptations.
    10·1 answer
  • How do covalent molecules form?
    8·1 answer
  • What is the definition of isotope
    10·1 answer
  • What was Charles Darwin's most important impact?
    14·1 answer
  • Is it true that the breakdown of food molecules in the gut does not require coupling of atp hydrolysis, but enzymes are required
    10·1 answer
  • We often say ‘it is freezing ‘ when the temperature is cold outside. Explain why this is not an accurate statement.
    5·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Describe how diffusion and osmosis move substances through a plant. Must have two examples.​
    15·1 answer
  • What is net force on each item? Type in the number and select the direction from the units.
    15·1 answer
  • HELPPPPP
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!