I need someone to help me!!

Biology

2 answers:

zalisa [80]2 years ago

5 0

Answer:

I believe the answer is B. Vomiting and Fever.

Explanation:

This answer makes the most sense as spoiled food can lead to sickness, which can lead to vomiting and fever.

ahrayia [7]2 years ago

4 0

Throw up. And fever. I’d say pick this because if u eat un properly refrigerated or chilled sushi. You could get sick from parasites, food poisoning, or mercury ingestion. Same thing as throw up or fever basically u would get very sick. So pick throw up and fever

You might be interested in

How are the carbon, nitrogen, and oxygen cycles similar? a. they are all biogeochemical cycles. b. they all involve an interacti

professor190 [17]

D because carbon, nitrogen, and oxygen are apart of like everything

7 0

2 years ago

What codes for proteins?

Tju [1.3M]

Answer:

Explanation:

The R in RNA stands for Ribosomes which are proteins.

7 0

3 years ago

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0

2 years ago

When is competition reduced in a habitat

Ne4ueva [31]

When the species dies.

3 0

3 years ago

A male is heterozygous for the trait that produces freckles on the skin, and he has freckles. if he marries a woman who is also

kakasveta [241]

F- allele for freckles
f- allele without freckles

1) The man is heterozygote and has freckles, its indicating that the allele for freckles is dominant.
A cross between him and a woman who is also heterozygote: Ff x Ff
it would result in the following probabilities:
- 1/4 - homozygote with freckles: FF
- 2/4 - heterozygote with freckles: Ff
- 1/4- homozygote without freckles:ff

Their son would have a probability of 75% of being born with freckles.

2) The cross resulted in this probabilities:
- 1/4 - homozygote with freckles: FF
- 2/4 - heterozygote with freckles: Ff
- 1/4- homozygote without freckles:ff
So, the chance of being born heterozygote for this gene is 2/4, which is the same as half (50%).

6 0

3 years ago