<span>The filament of a flagellum rotates in a kind of sinusoidal motion, resembling a ship’s propeller or a corkscrew. Since the flagellum pushes instead of pulls, it is located at the rear of the microorganism. If there is more than one, they may act as a bundle. The direction of rotation determines the path of the microorganism. Flagella also serve as sensors, particularly for the detection of moisture.</span>
Answer:
Explanation:
<em>Fermentation does not involve an electron transport system, and no ATP is made by the fermentation process directly. Fermenters make very little ATP—only two ATP molecules per glucose molecule during glycolysis. ... During lactic acid fermentation, pyruvate accepts electrons from NADH and is reduced to lactic acid.</em>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
