1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
8

What will most likely happen if there is a change in

Biology
1 answer:
wel3 years ago
7 0

Answer:

Explanation:

Molecule 1 represents a segment of hereditary information, and molecule 2 ... What will most likely happen if there is a change in the first three subunits

You might be interested in
During protein synthesis the cell uses a
vlabodo [156]
During protein synthesis the cell uses information from messenger RNA
4 0
3 years ago
Bacteria and other microbes can be used to \"clean up\" an oil spill by breaking down oil into carbon dioxide and water. two sam
Allushta [10]
The answer is B, i think
5 0
3 years ago
You set up an experiment with yeast grown on lots of food (glucose) vs. very little glucose. Would you expect to see differences
k0ka [10]

Answer:

yes

Explanation:

The RNA, is composed by the carbohydrate called ribose, that is not glucose but it is made based of the glucose.

The pentose phosphate path, is a metabolic path in which is closely related with glucolisis, the metabolic path in which glucose is turned into energy in human body.

If there is a living thing in which the environment is poor in glucose, it can produce some RNA, but not the necessary to produce the proteins that the cell need.

3 0
3 years ago
Which is the major organ of the immune system?
ser-zykov [4K]
The major organ is the Kidney
4 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Describe the Watson and Crick model of DNA structure. How did it fit the data provided by Chargaff and the X-ray diffraction pat
    13·1 answer
  • A forensic scientist reports that the blood type from a fight scene and that of a suspect are both blood type
    12·1 answer
  • What is an ecological system called that consist of all of it to biotic and abiotic factors?
    9·2 answers
  • Which process or stage occurs during incomplete metamorphosis?
    15·1 answer
  • 17. Summarize the theories on how life on Earth began
    9·1 answer
  • What happens to carbon dioxide molecules that result from kerbs cycle?
    5·1 answer
  • Two species regularly come into contact and form hybrids that have higher fitness than either of the parental species. what are
    11·1 answer
  • Which statement most completely.describes the role of a cell in a single cell organisms
    12·1 answer
  • 1. List five units of measure in common use
    10·1 answer
  • What is Natural asexual reproduction.​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!