1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimaraw [331]
3 years ago
11

17. A place where two tectonic plates collide is called a ______ boundary and is often associated with _____ faults. ​

Biology
1 answer:
NNADVOKAT [17]3 years ago
4 0
Convergent is the first blank i don’t know the second i’m sorry.
You might be interested in
A classmate states that animals that result from artificial selections are lucky since they have better traits than bred animals
Delvig [45]

Answer:

See answer below. Hope it helps.

Explanation:

This can have advantages and disadvantages. The artificially selected animals could have better traits than naturally selected animals, but in the long run, it will be harder for them to evolve and adapt to new environments because of the lack of variation in their traits.

3 0
2 years ago
In a cell with defective chaperones, Question 14 options: proteins would not be able to exit the ribosome. the concentration of
BartSMP [9]

Answer:

the concentration of misfolded proteins would be higher than normal.  

Explanation:

Chaperones proteins are required for the correct protein folding of proteins. These proteins were first discovered in bacteria. The level of chaperones is increased under thermic stress conditions, it is for that reason that they are also known as heat shock proteins (Hsp). For example, Hsp70 is a chaperon protein constitutively expressed under stress conditions that is involved in the folding of protein precursors and the refolding of misfolded proteins. In humans, Hsp70 is encoded by the HSPA1A gene, and its increased expression level is related to different health problems including neurodegenerative diseases, cerebral ischemia and epilepsy.

5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which of the following environments would not contain fossils
juin [17]

Answer:

as I know

Explanation:

<em>Igneous rocks, which form from cooling magma or lava, and metamorphic rocks, which have been altered by heat and pressure, are unlikely to contain fossils. The “soft” tissues of an organism, such as skin, muscles, and internal organs are typically not preserved as fossils.</em>

4 0
2 years ago
An ice fisherman has fallen through the ice. In response to the cold water, sensors in the man's skin send a "cold" signal to th
Svet_ta [14]

Answer:

Hypothalamus

Explanation:

The hypothalamus is a part of the brain which possesses temperature receptor cells that detect changes in the man’s temperature, thereby sending signals in the form of electrical nerve impulses to the man’s muscles and nervous system, which in turn respond in counteracting the drop in the normal temperature of the body.  

Once the muscle cells of this man receive these signals, they produce heat through thermogenesis by shivering when the muscle cells begin to contract. This is one of the mechanisms by which thermoregulation is achieved as controlled by the hypothalamus in the brain of the man.

6 0
3 years ago
Other questions:
  • Which factor does not affect soil formation? type of rock time of exposure surface area animal intrusion
    14·1 answer
  • ________ is composed of multiple globular molecules polymerized to form long chains or filaments.
    10·1 answer
  • Describe electrons.<br> Location:<br> Charge:<br> Mass:
    6·2 answers
  • What do you think should be done and why?
    7·1 answer
  • The phylum Cycliophora was discovered in 1995. They are tiny organisms that live in large numbers on the outsides of the mouthpa
    11·1 answer
  • In which phases is chromatin condensed?
    9·1 answer
  • A heterozygous round seeded plant (Rr) is crossed with a homozygous round seeded plant (RR).
    7·1 answer
  • Which of the following is a characteristic shared by all members of the kingdom Protista?
    15·1 answer
  • Human genome experiment purpose
    12·2 answers
  • Q1/ In cellular respiration is H2O a waste product ?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!