1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
8

Why are the leaves important to a plant?

Biology
2 answers:
sergey [27]3 years ago
7 0
Yea he is right it’s C
Veronika [31]3 years ago
6 0
Answer: C: Contain chloroplast that perform photosynthesis.

Explanation: Process of elimination deems C correct!
You might be interested in
What does LOL mean ?
hammer [34]

Answer:Laugh Out Loud

Explanation:

8 0
3 years ago
Read 2 more answers
What is an interconnection of food chains in an ecosystem?
Maksim231197 [3]

The answer is food web

8 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Choose all the answers that apply.
____ [38]

increase because of carbon

4 0
3 years ago
Read 2 more answers
If you didn't have macrophages in your body then,
Dovator [93]
<span>You wouldn't be able to defend against germs</span>
6 0
3 years ago
Other questions:
  • What adaptation allows the Artic fox to survive in its environment?
    10·1 answer
  • What is the difference between osmosis and diffusions?
    5·2 answers
  • What is the process in which the 6-carbon sugar glucose is broken down into 2 3-carbon pyruvic acid molecules. Select one: a. Ci
    6·1 answer
  • POH measures the concentration of<br> ?
    9·2 answers
  • The unequal heating of Earth occurs because at the_____, more solar energy is received than is radiated back to space, and at th
    12·1 answer
  • CRQ QUESTION: A species of birds lives on an island. The thickness of the birds’ beaks varies within the population. The birds f
    11·2 answers
  • When something is_____ it is<br>used to make something else.<br>it is processed and then​
    12·1 answer
  • Aaron may have a phobic disorder if he had his first panic attack on his first day at a new high school. Please select the best
    14·1 answer
  • You are a tomato farmer whose crops are threatened by a persistent species of beetle. Each year, you spend large sums of money f
    8·1 answer
  • Correct or not? <br><br>Confirmation ​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!