1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
10

Write the entire name of dna

Biology
2 answers:
notsponge [240]3 years ago
6 0

hunter p***** 910*******

PilotLPTM [1.2K]3 years ago
4 0

deoxyribonucleic acid

You might be interested in
How does the body respond to medicine? Check
Irina18 [472]

Answer:The immune system is a complex network of cells and proteins that defends the body against infection.

The immune system keeps a record of every germ (microbe) it has ever defeated so it can recognise and destroy the microbe quickly if it enters the body again.

Abnormalities of the immune system can lead to allergic diseases, immunodeficiencies and autoimmune disorders.

Explanation:

7 0
3 years ago
The unit of force is the:<br> pound<br> newton<br> foot<br> gram
Papessa [141]

Answer:

Force has units of Netwons

4 0
2 years ago
HELP PLS/ A large bottle with a layer of mud on the bottom is filled with pond water. Several fish and some green plants are the
motikmotik

Answer: C: Decomposers

Explanation: The mud and pond water likely contain some sort of <em>decomposing bacteria</em>. These bacteria can break down the complex nitrogen compounds in the dead fish, <em>producing simple nitrogen compounds.</em> These simple nitrogen compounds can then be used by the plants added to the terrarium.

A is wrong because <u>producers (such as the green plants added to the terrarium) can not break down the complex nitrogen compounds</u> in the fish's body.

B is wrong for a similar reason. <em>Algae are primary producers.</em> Because of this <u>they also lack the ability to break down the complex nitrogen compounds</u> found in the fish's body.

D is also wrong. A virus may be able to infect the fish and cause disease, but <u>it lacks the ability to break down the complex nitrogen compounds </u>found in the fish's dead body.

Since A, B, and D are wrong, along with the fact that we know that decomposers <em>can</em> break down the complex nitrogen compounds in the dead fish, we can conclude that C is the correct answer.

6 0
2 years ago
Proteins destined for the following locations are sorted in the trans-Golgi:
taurus [48]

Answer:

A

Explanation:

Golgi apparatus is an organelle in eukaryotic cells that stores and modifies (might include addition of sugar groups) proteins and lipids for certain functions and prepare them for transport to other parts of the cell.

In the Endoplasmic reticulum, proteins fold into into their correct shape. Some of them are transported to the Golgi apparatus in membrane vesicles. Some proteins need to do their jobs in the Golgi (they are said to be Golgi-resident). They are transported from the golgi appratus to their final destinations through a secretory pathway. It involves sorting proteins into different kinds of transport vesicles, which emanate from the trans Golgi network and deliver their contents to the appropriate cellular locations.

Proteins that are membrane embedded are conveyed to the plasma membrane (integral membrane proteins) by constitutive secretion. Proteins can divert from constitutive secretion pathway and be targeted towards other destinations such as lysosomes (as lysosomal proteins) and regulated secretion from cells (to the cell exterior).

8 0
4 years ago
HELP ASAP
PolarNik [594]

Answer:

??????????????????????????????????

Explanation:

7 0
3 years ago
Other questions:
  • Using the crisscross method, what is the chemical formula for the ionic compound created when potassium (K) combines with Sulfur
    10·1 answer
  • Some worry that many elderly who display normal forgetfulness and other common features of growing older will incorrectly receiv
    11·1 answer
  • Why is the zone of aeration termed as such
    11·1 answer
  • Why should farmers be concerned about unused nitrates contaminating surface water and groundwater supplies?
    7·1 answer
  • A scientist helps a colleague do a better expirement by:
    11·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • If you hiked in Pocahontas State Park 100 times last year and you saw a White-crowned Sparrow 43 times, what is the probability
    5·2 answers
  • Pls help! on gregor mendel
    12·1 answer
  • HOW ARE ROCKS, ELEMENTS, &amp; MINERALS RELATED?
    9·1 answer
  • What takes blood away from the heart?<br><br> i need it rn or else i fail this test :c
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!