1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
5

What statement about childhood obesity is true?

Biology
1 answer:
MakcuM [25]3 years ago
4 0

Answer:

Obesity can lead to high blood pressure.

You might be interested in
Which organelle is outside the cell membrane?
statuscvo [17]

Answer:

c

Explanation:

I think I remember fro.5th grade

7 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
The processes of photosynthesis and cellular respiration are complementary. During these energy conversions, some energy is:____
erma4kov [3.2K]

Answer:

the answer is C, destroyed when the chemical bonds of glucose are made or it might be D, saved in the chemical bonds of water

Explanation:

i hope i helped :)

8 0
3 years ago
How much magma is formed at a transform boundary<br> i need this asap
saul85 [17]

Answer:

magma doesnt form at transform boundaries, but it does form at divergent and convergent bounderies.

Explanation:

The divergent boundaries pull apart from each other creating a weak spot in the crust, allowing magma o come through and reach the surface. Some of the rock above the subducting plate melts and forms magma. Because the magma is less dense than the surrounding rock, it rises to the surface.

At convergent boundaries magma is formed where water from a subducting plate acts as a flux to lower the melting temperature of the adjacent mantle rock

i hope this helps a little bit (:

7 0
2 years ago
Select the correct answer from each drop-down menu. The force of gravity between two objects depends on and .
zubka84 [21]
Depends on two factors: mass and distance.
5 0
4 years ago
Other questions:
  • Which organelles are found only in plant cells?
    14·2 answers
  • How does the nonpolar nature of lipids contribute to their insulating quality
    11·1 answer
  • Which of the following infectious agents cannot live outside of a human body for extended periods of time?
    15·2 answers
  • Shoud a patient with a history of smoking be moved to the top of the transplant list?
    5·1 answer
  • Please help me I would appreciate it
    15·2 answers
  • What is the mass of a proton in scientific notation
    9·2 answers
  • Is any guy just bored and what a good girl best friend im 16 and a great person
    10·1 answer
  • What role does mutation play in the evolution of an organism?
    6·1 answer
  • Proteins regulate cell process, transport substances into or out of cells, and help
    9·2 answers
  • Question 10: If this scenario continues, what do you think will happen to the populations in the next 100 years? Why do you thin
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!