1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
3 years ago
11

Weathering and erosion contribute to the creation of landforms that contain nutrient-rich soil for plant growth. Put the followi

ng processes used to create nutrient-rich soil in the correct order.
1
multiple cracks cause large rock to break into smaller rocks

2
water infiltrates existing cracks in large rocks

3
small rocks experience abrasion from winds that contain sand particles

4
sediment combines with organic material

5
rocks expand when exposed to Earth's surface and pressure decreases

What order please??
Biology
2 answers:
givi [52]3 years ago
7 0

Answer:

-5

-3

-1

-4

-2

Explanation:

Contact [7]3 years ago
4 0
First-5
Second-3
Third-1
Fourth-4
Fifth-2
You might be interested in
Which portion of a phospholipid molecule would be facing the environment outside of the cell?
SIZIF [17.4K]
The hydrophilic (water-loving) head.
7 0
2 years ago
What are the four classes of biomolecules
zalisa [80]
<span>-Carbohydrates. Carbohydrates are comprised of carbon (C), hydrogen (H), and oxygen (O) molecules. 
-Proteins. Proteins are comprised of amino acids. 
-Lipids. A wide variety of biomolecules including fats, oils, waxes and steroid hormones. 
<span>-Nucleic Acids.</span></span>
8 0
2 years ago
How are viruses different from bacteria
Viktor [21]

C is the correct answer i think, because scientist do not consider them as living since they lack the properties that all living organisms have or should have

5 0
3 years ago
How can you distinguish between an energy transfer and energy transformation
tia_tia [17]

Answer: Energy transfer is the movement of energy from one location to another. Energy transformation is when energy changes from one type to another. While energy can be transferred or transformed, the total energy always remains the same.

4 0
2 years ago
When a male pig from a line of true-breeding (homozygous) black, solid-hooved pigs was crossed to a female from
natita [175]

Answer:

When a male pig from a line of true-breeding (homozygous) black, solid-hooved pigs was crossed to a female from a breed (homozygous) of red, cloven-hooved pigs, their several progeny all looked alike with regard to color and hooves. These progeny were all mated to members of the same breed as their red, cloven-hooved mother pig. The offspring from this final cross were: 11 black, cloven-hooved; 8 black, solid-hooved; 14 red, cloven-hooved; and 10 red, solid-hooved. For each of these two genes (coat color and hoof type) determine which allele is the dominant one. Explain your reasoning. What were the phenotypes of the progeny produced by the first mating in this problem.

3 0
2 years ago
Other questions:
  • What is a cost of using technology to transport water?
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which coal is on the bottom layer ?​
    8·2 answers
  • Which of the statements would BEST serve as a topic sentence for a paragraph?
    12·2 answers
  • Our experiment was to keep one seedling set in a light place and the other set in a closed cardboard box. So my question is to e
    10·1 answer
  • I need help on two of these please i give 20 points
    7·2 answers
  • Help me please!ifkkfkdud
    11·1 answer
  • What is an adaptation? What happens if the adaptation has a positive affect?
    7·2 answers
  • In a certain species of cactus the cactus plant can be covered in Y shaped spines or X shaped spines. When crossing a cactus wit
    9·1 answer
  • which of these is a product of photosynthesis and a requirement for cellular respiration? a) carbon dioxide b) glucose c)water d
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!