1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
5

Which organism would likely increase if the frogs were removed from the ecosystem?

Biology
1 answer:
Vika [28.1K]3 years ago
5 0

Explanation:

B

............ I need 20 lettera

You might be interested in
Which organ in the body regulates temperature
butalik [34]

Answer:

2 possible ones

Explanation:

Skin - Due to vasoconstriction and vasodilation

Brain - the hypothalamus regulates temperature

4 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
What do you think are the possible alleles for eye color in humans?
Sav [38]

Answer:

I'm not sure but i think its brown and blue

8 0
3 years ago
WILL GIVE THE BRAINLEST
Lesechka [4]

Answer:

#2 is B #3 is

Explanation:

Plant cells have cell walls around them, and animal cells don't have cell walls. The cell walls give plant cells their boxy shapes. That's nice for plants, because it gives them the ability to grow up and out, where they can get lots of sunlight for making their food.

The nucleus maintains the integrity of genes and controls the activities of the cell by regulating gene expression- the nucleus is, therefore, the control center of the cell.

4 0
3 years ago
Help me, please!!! This is a Bio quiz due tomorrow.
tamaranim1 [39]

Answer:

2] conserve salt 1] requires the presence of a membrane protein

Explanation:

easy your welcome enjoy your A+

7 0
3 years ago
Other questions:
  • Where on earth is the greatest amount of oxygen stored?
    11·1 answer
  • Meiosis results in half the number of chromosomes as the original. True False
    12·2 answers
  • Female cones produce what? Which contain eggs
    12·2 answers
  • A sample of basalt has smaller crystals than a sample of granite. What is the most likely reason for this? The basalt
    12·1 answer
  • During an experiment if you purposely change the temperature to test a hypothesis the temperature is called the what?
    13·1 answer
  • Based on your understanding of the periodic table, which list contains ONLY nonmetals?
    9·1 answer
  • Help me with this picture please
    6·2 answers
  • What takes carbon out of the environment?
    7·1 answer
  • Destin Benning: Attempt 5
    14·1 answer
  • Match the following vocabulary words with the correct definitions.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!