1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
13

Rational Numbers:Question 7

Mathematics
1 answer:
nevsk [136]3 years ago
5 0

Answer:

<em>-5, -3 = Quadrant |||</em>

Step-by-step explanation:

-3, 5 = Quadrant ||

4, 2 = Quadrant |

2, -4 = Quadrant |||| (Quadrant |||| is also known as Quadrant IV)

<u><em>~ LadyBrain</em></u>

You might be interested in
Find the value of x, rounded to the nearest tenth. Answers : a.)12.5 b.)9.7 c.) 10.0 d.) 13.0
Anuta_ua [19.1K]

Remember "SOH CAH TOA"


Sine = (Opposite/Hypotenuse)

Cosine = (Adjacent/Hypotenuse)

Tangent = (Opposite/Adjacent)


In this case, we will be using cosine, and our equation will be \frac{cos(28)}{1} =\frac{11}{x}


So firstly, cross-multiply. cos(28)*x=11


Next, divide both sides by cos(28), and your answer will be x=12.5

5 0
4 years ago
Read 2 more answers
Use a protractor to draw a parallelogram that has side lengths of 8 centimeters and 6 centimeters and two adjacent angles that m
photoshop1234 [79]

Answer:

B. 40 degrees and 140 degrees.

Step-by-step explanation:

please tell me if this is wrong

4 0
2 years ago
Explain how you can use division to simplify a complex fraction.
PolarNik [594]
Reduce the final answer if needed (or reduce when you multiply).  A mixed number should be converted to an improper fraction (heavier on top) before simplifying. Change the numerator and denominator to single fractions<span> by creating a common denominator</span>
3 0
4 years ago
An employee compiled sales data for a company once each month. The scatter plot below shows the sales (in multiples of $1000) fo
Y_Kistochka [10]
The answer is e $940
5 0
3 years ago
Read 2 more answers
What is BC ?<br><br> Enter your answer in the box.
stiks02 [169]
Mathematically it would be 8 since BE=CE and CE=4. 
5 0
3 years ago
Other questions:
  • In your own words, explain the place value relationship when the same two digits are next to each other in a multi digit number.
    9·1 answer
  • Two quantities are related, as shown in the table:
    9·1 answer
  • The Triangle Shirtwaist fire: a. resulted in laws that banned all manufacturing in New York. b. occurred during the Uprising of
    11·1 answer
  • Which answer is it for this wuestion really need to know
    10·1 answer
  • Use synthetic division with the factor x + 1 to completely factor LaTeX: x^3+2x^2-5x-6x 3 + 2 x 2 − 5 x − 6.
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Solve for v.<br><br> –5v = 3v − 16
    14·2 answers
  • 3. All boys at a certain High school play basketball, tennis or volleyball. If 31% play basketball, and 45% play tennis, find th
    10·1 answer
  • HELP! I WILL GIVE BRAINLIEST!
    13·2 answers
  • Pick the Quadrant that you would plot (-6,-3)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!