1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
3 years ago
11

What must be the genotype?​

Biology
1 answer:
Sonbull [250]3 years ago
7 0

Answer:

XnY

Explanation:

II-2 is a male so the genotype must have a Y in it. Majority of the other options do not have Y, so they are incorrect. Because the individual is male, the father has passed a Y chromosome, while the mother has passed an X chromosome. The X chromosome is Xn because the mother is hemolytic, which is a recessive trait. So both the mother's X chromosomes carry the hemophilia trait.

You might be interested in
Mary Morgan has just been brought into the emergency room of City General Hospital. She is perspiring profusely and is breathing
timurjin [86]

Answer:

The insulin must be administered.

Explanation:

In the given question the Mary has the acidosis that is the level of pH in the blood have dropped below 7.  

It is also provided that the smell of her breath is fruity due to the accumulation of fruity smell molecules called ketones which could be the result of the ketosis. Ketosis occurs when the cellular respiration uses fat as a substrate instead of the carbohydrate. This shows Mary has a condition called ketoacidosis.

The increased level of the glucose in the blood shows that the glucose is not absorbed by the cell which involves the insulin therefore the doctor should administer the insulin drug to the patient.

Thus, insulin is the correct answer.

4 0
3 years ago
Which molecular activity requires a folded structure?
Mice21 [21]

B -  Because an active cell can only work if it has a 3-Dimension structure.

7 0
3 years ago
What is chlorophyll and where is it located? in a short answer pls
Anuta_ua [19.1K]

Answer:

a green pigment, present in all green plants

Explanation:

3 0
2 years ago
Read 2 more answers
If a virus has an envelope structure, what is the process called for how it was<br> formed?
myrzilka [38]

Answer:

A virus that has an outer wrapping or envelope. This envelope comes from the infected cell, or host, in a process called "budding off." During the budding process, newly formed virus particles become "enveloped" or wrapped in an outer coat that is made from a small piece of the cell's plasma membrane. Hope this helps!

Explanation:

5 0
3 years ago
What is the history of biology and which development has brought the most benefits to humanity?
ddd [48]
What brought the most benefits to humanity was probably the discovery of DNA. The history of biology came to be from Egyptian methods of medicines and native traditions.
5 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What substance makes up 75 to 90% of every cell in the human body?
    13·2 answers
  • Please Help Quick!
    6·1 answer
  • Why doesn't a ball roll on forever after being kicked at a soccer game
    5·2 answers
  • What is a defining trait of all minerals?A) Made of carbon B) Orgnaic C) shiny D) crystalline structure...Please help
    9·2 answers
  • Is Helicase functional in elongation?
    9·1 answer
  • Please help me with these 2 ?!
    14·1 answer
  • 20 POINTS
    12·2 answers
  • Please HElp!!!!!!!!!!!!!!!!!!!!!
    6·2 answers
  • A gas delivers 874 J of heat and then has 159 J of work done upon it. The change in internal energy of the gas is
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!