1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
7

Teoria criacionista?​

Biology
1 answer:
valentinak56 [21]3 years ago
8 0

Answer:

Creationism is the religious belief that nature, and aspects such as the universe, Earth, life, and humans, originated with supernatural acts of divine creation.[1][2] In its broadest sense, creationism includes a continuum of religious views,[3][4] which vary in their acceptance or rejection of scientific explanations such as evolution that describe the origin and development of natural phenomena.[5][6]

The term creationism most often refers to belief in special creation; the claim that the universe and lifeforms were created as they exist today by divine action, and that the only true explanations are those which are compatible with a Christian fundamentalist literal interpretation of the creation myths found in the Bible's Genesis creation narrative.[7] Since the 1970s, the commonest form of this has been Young Earth Creationism which posits special creation of the universe and lifeforms within the last 10,000 years on the basis of Flood geology, and promotes pseudoscientific creation science. From the 18th century onward, Old Earth Creationism accepted geological time harmonized with Genesis through gap or day-age theory, while supporting anti-evolution. Modern old-Earth creationists support progressive creationism and continue to reject evolutionary explanations.[8] Following political controversy, creation science was reformulated as intelligent design and neo-creationism.[9][10]

Explanation:

its help you

You might be interested in
What is a benefit of a nerve plexus? what is a benefit of a nerve plexus? they provide a straight path from the spinal cord to t
adelina 88 [10]
<span>Answer: they provide a straight path from the spinal cord to target muscles.</span>
4 0
3 years ago
What impact would an artificial leaf have on environment?
lilavasa [31]
An artificial leaf could replicate photosynthesis but instead it would also be artificial which then produces hydrogen fuel that will be energy efficient and carbon neutral. hope this helps.
8 0
3 years ago
Helpppppppppppppppppppppppppppppppppppppp
sineoko [7]
A, an example is our sun :)
4 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Two brothers inherit different sets of alleles from their parents. what effect will they have?
lesya692 [45]
Depending on what trait the alleles carry, the brothers will have a different phenotype and a different genotype.
For example; Eye color. My sister is heterozygous, meaning she has brown eyes. I am homozygous recessive, meaning I have blue(green/hazel) eyes. We both have the same parents, I just happened to inherit both of the recessive eye color alleles from my parents whereas, my sister inherited both the dominant and recessive alleles. 

So, since the brothers inherited different sets of alleles, their genotype for a certain trait will be different.
6 0
3 years ago
Read 2 more answers
Other questions:
  • According to the diagram of the water cycle, what happens to the water in the oceans before it becomes water in the atmosphere?
    6·2 answers
  • What are some examples of abiotic factors within an ecosystem?
    14·1 answer
  • Causes water molecules to rise up from the roots eventually reaching the leaves?
    15·1 answer
  • Which of the following is a part of the morphology (structure) of fish?
    15·1 answer
  • Discuss respiration in plants​
    12·1 answer
  • True or false cleavage and fracture refer to the same way in which a mineral breaks
    13·1 answer
  • State any one way of controlling the spread of ringworms among children​
    12·1 answer
  • Three bird species share a habitat Bird A eats insects and plant seeds. Bird B drinks flower nectar. Bird C eats plant seeds. A
    13·1 answer
  • How many palindromic years will there be in the twenty_first century?​
    15·2 answers
  • Consider the cell body of a neuron. through which types of ion channel might sodium enter the cell body?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!