Answer:
First, the raised hammer has more potential energy since it has the potential to go higher or lower. Second, when you hit the hammer on the table, the stored potential energy is converted to kinetic energy as the hammer is falling. (It's the falling hammer that has kinetic energy)
Explanation:
Another example-When rolling a ball down a ramp the ball at its highest point has potential energy but when it rolls down the ramp it converts to kinetic energy
Hope this helps :)
You would most likely find it in the plants stem.
Answer:
Yes why would he do that in the first place I hope you are ok
Explanation:
Answer:
C. Helicases
Explanation:
Helicases to be termed as enzymes that is blind and contains acid i.e. remodel nucleic or have protein i.e. nucleic acid. It is important as the time of DNA replication as it divided the DNA i.e. double stranded into one single standard that permits each and every strand for copied it
Also it cracks the bonds i.e. hydrogen that lies between the two strands this could create a replication fork.
Therefore in the given case, the helicases is affected
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
