1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
3 years ago
14

The real length of one villus is 0.8 mm

Biology
1 answer:
raketka [301]3 years ago
5 0

Answer: 16 mm

Explanation:

If I understood the given equation correctly, it could be rewritten as:

size of image = size of real object * magnification

Plug in the given values, and we get

size of image = 0.8 * 20 = 16 (mm)

You might be interested in
What makes a dominant allele different from a recessive allele?
Drupady [299]
B). The dominant allele determines the trait
8 0
3 years ago
Read 2 more answers
A neuron cell body reaches threshold and depolarizes. The depolarization propagates down the length of the ______, is chemically
Alex787 [66]

Answer:

Axon.

Synapse

Dentrite and cell body.

Explanation:

AXON is the transmission conduit for action potential through saltatory conduction at the nodes of ranvier.

Synapse refers to the gap between adjacent nuerones and the entire components of that particular gap.

Denrites which originated from the cell.body received the transmitted signals from.the axon,and transmits this for response at effectors:muscle and glands.

6 0
3 years ago
Is there a difference between plant & animal cells?
Mandarinka [93]
Hope this helps you.

3 0
3 years ago
Read 2 more answers
HELP!
lidiya [134]

Answer:

A. Compounds contain fixed ratios of different elements.

Explanation:

Water always has this 2:1 ratio of hydrogen to oxygen. Like water, all compounds consist of a fixed ratio of elements. It doesn't matter how much or how little of a compound there is. It always has the same composition.

3 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • Why did Copernicus not tell anyone about his theory until his deathbed?
    6·1 answer
  • Which is the correct sequence of the transfer of information in most organisms?
    7·2 answers
  • Fertilizers,detergents, products made from petroleum, pesticides oil and gas are all examples of
    6·1 answer
  • Which of the following statements best describes what happens when a bacterial cell is placed in a solution containing 5 percent
    14·1 answer
  • Why are prokaryotes considered to be primitive compared to eukaryotes
    12·1 answer
  • Consider a population of 1099 apple fly maggots. In this population, you observe that the allele frequency of the dominant allel
    7·1 answer
  • Apply a small amount of heat to 5 grams of water and 5 grams of aluminum. The temperature of the aluminium increases more then t
    5·1 answer
  • The energy stored in food molecules in living cells is gradually released in a series of linked chemical reactions called a ____
    15·1 answer
  • What do prokaryotes have in common with eukaryotes?
    5·2 answers
  • Does the stratosphere have a high or low temperature also what is the temperature
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!