1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
2 years ago
7

A scientist is comparing the sequences of related genes among three species. Two of the species have very similar sequences, whi

le the sequence of the third species differs greatly from the others. T
Biology
1 answer:
Elena-2011 [213]2 years ago
5 0

Hi. The question you presented above is incomplete. This makes it impossible for this question to be answered. However, when searching for your question on the internet, I was able to find another question exactly like yours, which asked you to explain the evolutionary relationship between these three species. If that's the case for you, I hope the answer below will help you.

In a simplified way, we can infer that among the three species presented above, the third presented a faster evolution than the first two and this is what explains the difference between the gene sequences between the species. As the question presents, the three species have related genes, which indicates that they had a common ancestor, however the difference in the gene sequence of the third species shows that it evolved first, showing changes that cannot be noticed in the first two species that are evolving more slowly.

You might be interested in
It is important that the president _______ it is ridiculous that my friend _________ it is good that I_______ it is sad that man
azamat

Answer:

it is important that the president represents the people it is ridiculous that my friend thinks otherwise it is good that I don't think that way it is sad that many people passed from C19.

Explanation:

7 0
2 years ago
What kind of mixture can paint be classified as
Travka [436]

Answer:

colloid

Explanation:

5 0
2 years ago
Read 2 more answers
Sofia, a scientist, wants to change the DNA of a sexually reproducing organism and have the
aksik [14]
C is the correct answer because it is what that determines the gene
4 0
2 years ago
Read 2 more answers
What polygons are represented in tangram
IRINA_888 [86]

Answer:

Parallelogram

Rectangle

Triangle

Square

Explanation:

3 0
3 years ago
What do you call the two parts of a lift that goes down a mine?​
lina2011 [118]

I think its a The hoist cable

8 0
2 years ago
Other questions:
  • The cells in the retina (called rods and cones) that convert light energy into nerve energy are called ________.
    10·1 answer
  • During the winter of 2009, you contracted the influenza A (H1N1) virus, or swine flu. Which type of cell would recognize the vir
    9·2 answers
  • People with panic disorder show dysregulation of norepinephrine systems in an area of the brainstem called the:_________.a. basa
    11·1 answer
  • Voltage-activated channels are channels for which a change in the voltage across the membrane alters their ____.
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What causes surface tension in water?
    15·1 answer
  • A finch population eats seeds that vary in size. There is variation in preference of seed type, and that variation positively co
    12·1 answer
  • How does math go to our mind?
    7·2 answers
  • Scientists have studied a fruit fly, Drosophila, to better understand early embryonic development and have discovered that the c
    9·1 answer
  • Help please and thank you :)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!