1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
2 years ago
5

Which part of the eye identify the colors​

Biology
1 answer:
SCORPION-xisa [38]2 years ago
5 0

Answer:

hope it is use full to you

Explanation:

Cones are concentrated in the middle of the retina, with fewer on the periphery. Six million cones in each eye transmit the higher levels of light intensity that create the sensation of color and visual sharpness.

You might be interested in
Glucose,fructose,and sucrose are all carbohydrates. what elements make up all carbohydrates?
PolarNik [594]
All carbohydrates are made up of carbon, oxygen, and hydrogen.

The chemical formula for Glucose is C_{6}  H_{12}  O_{6} .
The chemical formula for Fructose is the same as that of Glucose. The difference between the two is how they are structured.
The chemical formula for Sucrose is C_{12} H_{22}  O_{11} .

As you can see in the chemical formulas of Glucose, Fructose, and Sucrose, they are all made up of the elements carbon, hydrogen, and oxygen.
5 0
3 years ago
Read 2 more answers
I need help asap:):):):)
cupoosta [38]

Answer:

Idk

Explanation:

7 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
ur data for diffusion of water across a differentially permeable membrane in response to a sucrose gradient could be graphed wit
musickatia [10]
The slopes show that sucrose gradient affects change in weight.

The slopes will be different because higher gradient concentration of sucrose will result in the higher amount of water moved. This means the higher sucrose gradient concentration, the more change in weight of the water. 
6 0
3 years ago
Why is the archaea domain closer to eukarya than bacteria?
harkovskaia [24]

Answer:

Archaea domain is closer to eukarya than bacteria because genetically they are more similar to Eukarya than Bacteria.

Explanation:

Options for this question are:

  • <em>They both lack a nucleus and contain  cytoplasm. </em>
  • <em>The unique functional adaptations of Archaea are more similar to Eukarya adaptations.  </em>
  • <em> They both evolved in the same geological time period. </em>
  • <em> </em><em>Genetically, the Archaea are more similar to Eukarya than Bacteria. </em>
  • <em> They both have membrane-bound organelles. </em>
  • <em> Archaea is not closer to Eukarya because it contains prokaryotic cells just like Bacteria.</em>

Archaea are unicellular prokaryotic organisms, which share many characteristics with bacteria, however, the existence of metabolic functions and genes similar to eukaryotic organisms suggest that there is a genetic link between the two. Even the enzymes responsible for genetic processing, such as transcriptases and translation enzymes, are similar to those in eukaryotic cells.

The theory that establishes the relationship between Archaea and Eukaryotic suggests the existence of a common ancestor, whose later evolution allowed an Archaea to join a protobacteria to form a eukaryotic cell, and hence their genetic relationship.

Learn more:

Three domains brainly.com/question/330218

4 0
3 years ago
Other questions:
  • Widows peak is dominant to no widows peak. Determine the genotype and phenotype ratios for a homozygous dominant female and a ho
    8·1 answer
  • What would you expect to happen if your blood sugar was 120mg / 100mL? be specific
    12·1 answer
  • What process completed division in a animal cell?
    12·2 answers
  • In an ecosystem, a population can be defined as ___.
    14·2 answers
  • Why is the cell membrane essential for cell homeostasis? Group of answer choices To create food for the body To make energy for
    7·1 answer
  • PLEASE HELP HURRY
    13·2 answers
  • The natural process by which species die off is called
    9·2 answers
  • Are proteins smaller than chromosomes?
    14·1 answer
  • Can someone pick one of these and do it for me I give brainless (EMERGENCY it’s due in 30 mins) please!!!!
    5·1 answer
  • D) 6. In a marine ecosystem, small fish must be able to
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!