1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
2 years ago
11

How many half-lives occur in 4 hours? A. 1 B. 2 C. 3 D. 4

Biology
1 answer:
Solnce55 [7]2 years ago
3 0
I believe the answer is C
You might be interested in
What single feature is primarily responsible for the variation of climate throughout different times of the year?
konstantin123 [22]

The Sun is the basic source of energy for the Earth which affect the growth of all living things and the Sun also affect the all the biochemical processes. We know that the amount of radiation from the Sun changes day by day due to the distance of the Earth from the Sun. The rate of Solar energy affects the Earth in two ways.

The rate of solar heating which directly affects the processes like the evaporation and condensation and indirectly it affects the cloud forming processes of the Earth. The rate at which the solar energy reaches the Earth is called as the Total Solar Irradiance or TSI. This affects the climate of the Earth in many ways.

The change in rate of cloud formation increases of decreases with the distance of the Sun from Earth and hence a warm, moderate or cold climate is formed

It also affects the formation of winds due to the low or high pressure in the water bodies and hence affect the climate in the coastal areas.

The tropical areas have hot and humid climate due to the equator which has maximum exposure to the Sun’s heat.

Hence, the Sun is one primary feature that affects the climate in the Earth.


7 0
2 years ago
Scientists build models based on what they know from previous research to derive testable hypotheses. Independently, both Watson
Trava [24]

Answer:

Nitrogenous bases contain the genetic information, their amount is variable among different species, and the arrangement of these bases is also variable among different species

Explanation:

Both Watson-Crick and Pauling's DNA models considered that DNA nitrogenous bases (i.e., Adenine, Cytosine, Thymine and Guanine) contain the genetic information that determines the characteristics of living organisms. Moreover, both DNA models also considered that nitrogenous base composition varies between species, as well as the arrangement of these bases in the DNA chain also varies between species. Based on these features, Linus Pauling considered that a model where nitrogenous bases would be arranged on the outside of the DNA molecule would be easier for the DNA molecule to be replicated, transcribed, or repaired. Although incorrect, Pauling's DNA triple helix model was fundamental to develop the helical (double-stranded) structure of DNA, which was finally discovered by Watson and Crick in 1953.

5 0
3 years ago
I need help as soon as possible!
Ymorist [56]

Answer:

so baicihly your not allowed to do this at test time boy

Explanation:

6 0
2 years ago
Read 2 more answers
What are the four kinds of acid precipitation ?
Sauron [17]
Acid rain, or acid deposition, is a broad term that includes any form of precipitation with acidic components, such as sulfuric or nitric acid that fall to the ground from the atmosphere in wet or dry forms. This can include rain, snow, fog, hail or even dust that is acidic.
3 0
3 years ago
Read 2 more answers
What type of snake is this?
Rashid [163]
I think that is a common garden snake
7 0
3 years ago
Other questions:
  • The relationship between the sea anemone and clownfish is best described as
    12·2 answers
  • In eukaryotic cells, the timing of the cell cycle is regulated by…
    13·2 answers
  • A 14 year old boy is 5'2" and he weights 110 lbs. he's prescribed by his doctor to take 5mg/kg of drug "a" daily. what will his
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What's the answer pleaseeeeeeee
    6·2 answers
  • How do fossil fuels affect the environment
    7·1 answer
  • A overhead light shines down on white paper. Which of the following terms best describes what happens to the light?
    13·1 answer
  • A student proposes that the cell types shown here can be classified as to plant,animal,fungal,and bacterial. The student also pr
    5·1 answer
  • What does the image refer to?
    5·2 answers
  • I have 10 minutes left
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!