1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vsevolod [243]
3 years ago
5

Help ASAP

Biology
1 answer:
ira [324]3 years ago
5 0
The answer is A

Explanation:because it has a cell wall but no nucleus
You might be interested in
Which of the following statements is true for a eukaryotic cell?
xeze [42]
Possesses the characteristic of compartmentalization  of organelles,wherein the organelles are bound by membranes 
8 0
3 years ago
Another form of extracellular fluid is that located in
igor_vitrenko [27]
The second type of body fluid, the extracellular fluid, have two types: the interstitial fluid and the intravascular fluid. The interstitial fluid serves as a messenger for transferring materials to and from cells. While the intravascular fluid is responsible for being within the circulatory systems of the body, being am addition of 4% of the body's weight.
5 0
3 years ago
Which of the following agricultural practices can increase water pollution?
Snowcat [4.5K]
L'utilisation de pesticides je pense...
6 0
2 years ago
Please help . Need answer right away
Bogdan [553]
That should help you

8 0
3 years ago
Which of the following came first in the scientific study of living organisms?
stira [4]
The answer is:

A) light microscope
5 0
3 years ago
Other questions:
  • When trying to evaluate whether a dog is showing strong aggression as opposed to strong fear, one can readily see the difference
    15·1 answer
  • A young child suffers a debilitating condition that includes progressive degeneration of the motor axons that innervate the mass
    7·1 answer
  • Which describes an image that a plane mirror can make? The image is always real. The image can be either virtual or real. The im
    15·2 answers
  • PLEASE ANSWER
    8·1 answer
  • The ________ is located deep within the brain, and it includes structures such as the substantia nigra and ventral tegmental are
    7·1 answer
  • The oceans, lakes, and rivers of Earth make up the what
    12·1 answer
  • Number the steps of the binary fission process in the correct order
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What kind of virus caused the 1918 pandemic?
    8·2 answers
  • How does DNA and evolution play a role in modern taxonomy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!