1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zheka24 [161]
3 years ago
7

Can we grow taller after puberty? like at 16?​

Biology
2 answers:
Rus_ich [418]3 years ago
8 0
Yep, however if you’re male you will see more of a difference but female to tend to grow
Alexxandr [17]3 years ago
7 0

Answer:

yes u can grow it depends on your secretion and what sex you have . female starts growing earlier but male starts late

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which of the following types of muscles are voluntary?
GuDViN [60]
b. skeletal muscles.
6 0
3 years ago
Why is the interdependence of the worms and plants an example of commensalism?
noname [10]
Because the plant is unaffected as the worms benefit
6 0
3 years ago
Read 2 more answers
The enzyme glucose oxidase isolated from the mold penicillium notatum catalyzes the oxidation of β-d-glucose to d-glucono-δ-lact
nignag [31]
The enzyme glucose oxidase isolated<span> from the </span>mold penicillium notatum catalyzes<span> the</span>oxidation<span> of </span>β-d-glucose<span> to </span>d-glucono-δ-lactone<span>. this </span>enzyme<span> is highly - 6641578. ... </span>enzyme<span> is </span>hihly specific<span> for the </span>β anomer<span> of </span>glucose<span> and </span>does not affect<span> the </span>α anomer<span>. in </span>spite<span> of this </span>specificity, the<span>reaction catalyzed</span>
7 0
3 years ago
Read 2 more answers
an organism is classified as a carnivore. is it a heterotroph or an autotroph? is it a producer, consumer, or decomposer?
kobusy [5.1K]

Heterotroph. Consumer

3 0
4 years ago
Other questions:
  • The most effective molecule for nitrogenous waste disposal in desert animals would be __________.
    7·1 answer
  • Parts of a newly formed mrna strand which are joined together
    7·1 answer
  • Jeremy has parkinson's disease, a progressive neurodegenerative disease that affects motor skills. in addition to motor symptoms
    5·1 answer
  • The bacteria Vibrio vulnificus is sometimes released into the ocean by sewage pollution. This small bacterium is often eaten by
    10·2 answers
  • What type of organisms use photosynthesis
    11·1 answer
  • A couch potato eats lots of pizza, chips, and hamburgers and never exercises, and develops arteriosclerosis, which includes hard
    12·1 answer
  • Over time, there will be heritable changes in which of the following?
    8·1 answer
  • A scientist found a new bacteria in a hot water sulfur spring that uses sulfur as a source of energy instead sunlight. What kind
    15·2 answers
  • Why do animals have adaptations?
    10·1 answer
  • in a certain plant, tall stems (T) is dominant over short stems (t). A farmer crosses two heterozygous long-stemmed flowers. Wha
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!