1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
2 years ago
11

I also need help with dis plz?

Biology
2 answers:
Evgesh-ka [11]2 years ago
3 0
Your answer would be the first one “prophase”
Explanation - prophase
During prophase, the complex of DNA and proteins contained in the nucleus, known as chromatin, condenses. The chromatin coils and becomes increasingly compact, resulting in the formation of visible chromosomes. Chromosomes are made of a single piece of DNA that is highly organized.
vekshin12 years ago
3 0

Answer:

<em>Hey</em><em> </em><em>my</em><em> dear</em><em> friend</em><em> </em><em>your</em><em> answer</em><em> is</em><em> </em><em>À </em><em>(</em><em>prophase</em><em>)</em>

Explanation:

<h3>During prophase, the complex of DNA and proteins contained in the nucleus, known as chromatin, condenses.</h3>
You might be interested in
2 identical space orbiting Jupiter one has a larger gravitational force why
Rama09 [41]
This is because,
If the probes are identical, then the one that feels a larger gravitational 
force is orbiting closer to Jupiter than the other one is.
3 0
3 years ago
What is the name of the particle that circles the nucleus of an atom?
pishuonlain [190]

Answer:

electron

Explanation:

elections circle the nucleus

7 0
3 years ago
How does the circulatory system interact with the digestive system ?
Alexandra [31]

The digestive system breaks down food molecules into their component parts, which are then absorbed by the circulatory system in the small intestine and circulated throughout the body. The digestive system diffuses nutrients into the capillaries and then through the circulatory system. The small intestine has folds called villi, and the villi contain tiny projections called microvilli. The microvilli absorb nutrients from digested food and transport it directly into the bloodstream where it can be used. Without the circulatory system, the body would not be able to absorb nutrients from the food we eat.

The circulatory system supplies the organs with blood and oxygen to keep them alive. Oxygen travels throughout the body including the digestive system. Like any organ, the digestive system requires more oxygen when metabolically active, for example after a meal. In addition, the digestive system plays a role in the acid-base balance in the body. Since H+ + HC03- exchanges with H20 and C02 within the intestine there is a production of carbon dioxide from the gut to the lungs.

The bloodstream carries nutrients that are broken by the digestive system from the food you eat. The circulatory system provides nutrients and oxygen to the organs of the digestive system.

8 0
3 years ago
Read 2 more answers
Give several advantages to passive solar heating uses and active solar system applications
Rina8888 [55]

Answer:A material designed to produce passive solar energy can achieve energy savings of 70%. In addition to this great advantage, we show you what are the main benefits that passive solar energy can bring us:

Reduced maintenance cost. Since it has no external equipment to harness the energy, the maintenance required will be practically nil.

It is 100% renewable energy. It does not emit polluting gases and helps to maintain the environment, in addition to being an inexhaustible source which is the sun and we can always have it.

Energy and economic savings.  

Reduction in the cost of electricity and gas bills.  

Compatible with solar panel installations. In fact, it is currently considered as a complementary technology.  

APPLICATIONS :Active solar energy is mainly used to obtain sanitary hot water, heating systems and to transform solar radiation into electrical energy.

Active solar technology is also used to produce air currents for ventilation or cooling and to store heat for later use. In any of these processes, the use of pumps and fans is required.

Other uses of active solar energy are:

Water purification.

Drying.

Evaporation.

Distillation.

Solar batteries.

Solar chargers.

Energy for street lighting, traffic signals and roads.

6 0
3 years ago
What is the greenhouse event primarily caused by​
Andrei [34K]

Explanation:

Greenhouse effect, a warming of Earth's surface and troposphere (the lowest layer of the atmosphere) caused by the presence of water vapour , carbon dioxide, methane, and certain other gases in the air. Of those gases, known as greenhouse gases, water vapour has the largest effect.

5 0
3 years ago
Other questions:
  • I need help with all of these
    11·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which organelle in this image is the packaging unit of the cell that packages proteins for transfer throughout the cell?
    11·1 answer
  • Describe what must come together in order for atp to be made
    13·2 answers
  • Which question is a testable
    6·1 answer
  • I lost a brain cell reading this . Can someone please help!! I will give brainliest :)))
    14·1 answer
  • The greenhouse effect is related to the phenomenon of an increase in average surface temperature known as
    10·2 answers
  • Which of these is a vascular plant?
    15·1 answer
  • What movements do the quadriceps femoris muscles perform?
    7·1 answer
  • Describe fully what will occur if a plant cell is placed in a solution that has a higher water potential than the cell. Use the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!