1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr [31]
3 years ago
6

Which organism would you expect to find at level D?

Biology
2 answers:
jek_recluse [69]3 years ago
7 0
D. Daisy
Idk hope this helps!!
Mandarinka [93]3 years ago
3 0

if you were looking for level C then the answer is rabbit, for apex user's

You might be interested in
Most organisms breathe using oxygen or carbon dioxide. Where do these gases come from on land?
bagirrra123 [75]

Answer:

Air

Explanation:

Because of the trees, we breath.

6 0
3 years ago
Read 2 more answers
What causes a light go out when you turn off the wall switch?
SIZIF [17.4K]
Turning off the switch breaks the electrical current to the light - no supply of energy, the light goes off.
7 0
4 years ago
Can someone pllllzzz help meee<br><br><br><br> plzz thxxxx
zhenek [66]

Answer:

a

Explanation:

it is in the passage

5 0
3 years ago
The process by which small pieces of rocks and soil are moved from place to place is called ________.
Natasha2012 [34]

Answer:

A. erosion

Explanation:

4 0
3 years ago
Read 2 more answers
Which system worked with the nervous system to maintain homeostasis?
Gre4nikov [31]
It is probably endocrine or muscular
3 0
3 years ago
Read 2 more answers
Other questions:
  • You are working in a clinical laboratory and you need to examine an unstained urine sample for the presence of bacteria. what ty
    9·1 answer
  • Which are characteristics of medusae?
    10·1 answer
  • The image below shows plant cells.
    15·1 answer
  • Match the computer discipline with its description? Focuses on developing software that is reliable, efficient, affordable, user
    5·1 answer
  • When moving upward on an energy pyramid from one level to the next, what happens to the usable energy in an ecosystem?
    6·2 answers
  • Which is all of the organisms found on earth and all of the areas in which they live
    8·2 answers
  • How does skin help with homeostasis? include the terms stimulus and response
    15·1 answer
  • What are the five general functions of epithelial tissue?
    6·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • During which stages of the cell cycle does a chromosome consist of two identical chromatids​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!