Answer:
Heterogeneous consists of the structure with various components or elements appearing to be irregular or variegated.
Explanation:
An example of this definition is a dermoid cyst in which has the components of a heterogeneous attenuation on CT.
Answer:
The given blank can be filled with operator.
Explanation:
The proteins that assist in turning on or turning off the function of a specific gene by getting combined with certain sections of the DNA are known as transcription factors. The transcription factors that activate the transcription of a specific gene are known as activators, while that prevents transcription and is termed as repressors.
A repressor can be an RNA or a DNA binding protein, which prevents the articulation of genes by getting combined with the operator. A repressor, which binds with DNA prevents RNA polymerase from getting combined with the promoter, which further inhibits the transcription of the genes into mRNA.
the answer i think be a area a has more predators then area b because if it was disease or lack of food source they wouldn't that low i think
DNA:GCTAGCAG
RNA:CGAUCGUC therefore, C is the correct answer.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.