1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
7

During the final stages of human gestation, receptors for the hormone oxytocin increase onthe smooth muscle cells of the uterus.

The release of oxytocin during labor stimulates thesmooth muscle tissue in the wall of the uterus. The vigorous contraction of the uterine smoothmuscle helps push the baby through the birth canal so that delivery can occur. This processinvolves the interaction of which organ systems? *
A)Endocrine and muscular only
B)Endocrine and reproductive only
C)Endocrine, muscular, and reproductive
D)Endocrine, reproductive, and excretory
Biology
1 answer:
scoray [572]3 years ago
7 0

Answer:

im not sure

Explanation:

You might be interested in
Why are compounds different from single elements?
In-s [12.5K]
The answer is a. I'm pretty sure
4 0
3 years ago
Question 25 of 34
guapka [62]
C. the fallen trees become food for organisms
7 0
3 years ago
الخصائص العامة للنباتات
lys-0071 [83]
النّباتات كائنات حيّة تنتشر في جميع أنحاء العالم، وهي تعيش على اليابسة أو في المسطحات المائيّة، وتضم مملكة النّباتات أكثر من 350,000 نوع من الأشجار، والشّجيرات، والأعشاب، والسّراخس.[١] تنتج النّباتات غذاءها بنفسها عن طريق عملية البناء الضّوئي، وهي عملية تحدث داخل البلاستيدات الخضراء التي تحتوي على مادة الكلوروفيل التي تحوّل الطّاقة الشّمسيّة وغاز ثاني أكسيد الكربون إلى غذاء.7
5 0
3 years ago
Why does the function of the hormone oxytocin in the progression of labor during childbirth illustrate a positive feedback mecha
Olegator [25]
Only B. illustrates a positive feedback mechanism. A. demonstrates a negative feedback mechanism, while C. demonstrates no feedback mechanism at all.
6 0
3 years ago
Read 2 more answers
7. Which statement correctly describes how the Sun's energy drives a process within the
abruzzese [7]

Answer:

c

Explanation:

6 0
4 years ago
Other questions:
  • The questions of how chemicals flow and energy cycles between organisms and their surroundings are addressed in the study of whi
    9·1 answer
  • Exploring the south american rianforest a scientist discovers a mysterious organism and brings it back to the lab for further st
    8·1 answer
  • Which occurs when the body responds to the environment by maintaining a stable internal environment despite changing external co
    11·1 answer
  • Why is the process in which rocks change called a cycle?
    6·2 answers
  • What is the gross anatomy of the skeletal muscles muscles of the head
    11·1 answer
  • If you were a researcher studying Taxol, you would be most interested in cells found in which phase of mitosis?
    9·2 answers
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • PLS HELP IVE BEEN ASKING FOR 2 DAYS OML NOBODY WILL HELP ;( ME GO CRY
    10·2 answers
  • I need help with biology please
    9·1 answer
  • The white of an egg consists mostly of a protein called ovalbumin. Under normal circumstances, ovalbumin is a sphere-shaped mole
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!