1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
7

Why is wind created when cold air rushes into an emptier space?

Biology
1 answer:
vova2212 [387]3 years ago
7 0

Answer:

A

Explanation:

You might be interested in
Mengapakah biodiversiti wujud
timofeeve [1]
Kk I’ll help please clarify.
7 0
3 years ago
Fluidity of the plasma membrane is a result of
posledela

Answer:

B)Cholesterol in the membrane

Explanation:

Membrane fluidity is affected by fatty acids. More specifically, whether the fatty acids are saturated or unsaturated has an effect on membrane fluidity. ... Membrane fluidity is also affected by cholesterol. Cholesterol can make the cell membrane fluid as well as rigid.

3 0
3 years ago
7. Explain the difference between disorders of chromosome number and disorders caused by
elena-s [515]

Answer:

A person can have normal chromosomes in number and structure, but still have a disease or condition caused by a mutation in one or more of the genes on the chromosomes. A single gene defect usually does not cause the chromosome structure or number to be abnormal.

Explanation:

I'm not sure if this is correct but hope it helps.

5 0
3 years ago
Define pressure potential.
elena-s [515]

Answer:

The component of water potential due to the hydrostatic pressure that is exerted on water in a cell. ... In turgid plant cells it usually has a positive value as the entry of water causes the protoplast to push against the cell wall (see turgor).

6 0
3 years ago
Read 2 more answers
The separation of a group of individuals from the rest of the population is referred to as
Natali5045456 [20]

Answer:

Alienation

Explanation:

In sociology, this is termed as alienation. Alienation is a kind of separation of a certain group of individuals from the major population group on several basis.  Some of the basis of Alienation are – caste, creed, color, financial differences, political difference, etc.  

According to Karl Marx Alienation has arisen primarily in industrialization era where workers were alienated from capitalist society

7 0
3 years ago
Other questions:
  • The criteria used to determine whether something is alive includes movement, growth and
    12·2 answers
  • Which of the following macromolecules are a prominent part of animal tissues that function in insulation, helping animals conser
    8·1 answer
  • Parasympathetic and sympathetic refer to the two branches of the
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • RR Lyrae, Cepheid, Population 11, Quasar. Out of all these which one doesn't belong?
    10·1 answer
  • Frogs go through metamorphosis.<br> a. True<br> b. False
    9·1 answer
  • Pls help me for brainliest
    10·2 answers
  • Why are ribonucleoside triphosphates the monomers required for rna synthesis rather than ribonucleoside monophosphates?
    14·1 answer
  • . Professor Dr. Uppal Pal studied the Borrelia burgdorferi bacterium at the University of Maryland. Dr. Pal found that Lyme dise
    14·1 answer
  • I need someone to write me an essay, please. Describe the different types of cellular transport and explain how the structure of
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!