1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ICE Princess25 [194]
2 years ago
10

3. Which of the following scenarios is least likely to be associated with a population exceeding

Biology
1 answer:
elena55 [62]2 years ago
4 0

Answer:

3. B. no new mating partners are available

7. D. best adaptations

8. C. survive and reproduce

Explanation:

Carrying capacity refers to the maximum population size of a species/population in a particular habitat. The carrying capacity depends on abiotic (e.g., shelter, water) and biotic factors (e.g., food, presence of mates). According to the evolutionary theory, individuals better adapted to their environments are more likely to survive and reproduce (i.e., produce more offspring) than other members of the same species. These 'better adapted' individuals will have more chances to pass their 'beneficial alleles' to the next generation.

You might be interested in
What is the cell membrane made out of
AlladinOne [14]

Answer:The Cell Membrane. All living cells and many of the tiny organelles internal to cells are bounded by thin membranes. These membranes are composed primarily of phospholipids and proteins and are typically described as phospholipid bi-layers.

6 0
2 years ago
Read 2 more answers
The cell wall of a plant consist mostly of cellulose a carbohydrates which provides a strong structure. which of the following e
jasenka [17]

Answer:

use SOCRACTIC IT WOULD REALLY BE HELP

5 0
2 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
LOTS OF POINTS!?!?!Where does the CO2 in the atmosphere come from?
allochka39001 [22]

Answer:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt. Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Explanation:

6 0
3 years ago
Read 2 more answers
When coding a diagnosis using the icd-10-cm, the coder should refer to the ______ ______ first?
Ronch [10]

Eu(dbm)3(Phen)/ACM17904835 can be provided in Alfa Chemistry. We are dedicated to provide our customers the best products and services. http://www.alfa-chemistry.com/eu-dbm-3-phen-cas-17904-83-5-item-282850.htm



4 0
3 years ago
Read 2 more answers
Other questions:
  • A key reason older adults suffer bone fractures is as a result of
    9·2 answers
  • Which is an example of adaptive social behavior?
    9·1 answer
  • Cells of a multicellular organism are specialized. What does this statement mean?
    14·2 answers
  • A structure that is in plant but not in animal cells
    5·1 answer
  • How have humans contributed to the increase in earthquake activity?
    7·2 answers
  • How long can humans hold their breath underwater?
    9·1 answer
  • What makes up amino acids
    12·1 answer
  • Meteorologists often try to predict what the high temperature of a day will be several days beforehand. Why do meteorologists no
    6·1 answer
  • A relationship in which one species benefits and the other neither benefits nor is harmed is
    6·2 answers
  • 4. Owls have large eyes that enable it to see well at night. Both the hawk and the owl hunt similar things: small rodents or sna
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!