1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
2 years ago
15

What are the 3 environmental stresses? Give examples for each of the stressors

Biology
1 answer:
son4ous [18]2 years ago
5 0
Stressors may be natural in origin, being associated with such environmental influences as:
competition, predation, disease, and other interactions among organisms
constraints related to climate or to inadequate or excessive nutrients, moisture, or space
disturbances such as wildfire and windstorms
You might be interested in
Is a crayfish a producer, primary, secondary, or tertiary consumer?
Lisa [10]
Well, cray fish are omnivorous which means they eat animals too. Secondary consumers eat animals.

Cray fish are secondary consumers.
6 0
3 years ago
Why are fats considered as high energy compounds?
jek_recluse [69]

Answer:

1. Fats contain mostly C-H bonds, it has less oxygen therefore making it a high energy compound

2. mRNA plays a vital role in protein synthesis. It's a single stranded RNA molecule that contains genetic information that can be taken outside the nucleus (unlike DNA which cannot leave the nucleus). Its created during transcrption, and is used during translation to create proteins

3. (Look at image)

6 0
3 years ago
I think the property developer should build a ........ because ......
podryga [215]

Answer:

a property  should build a Mcdonalds because not only does it taste good he'll make more money from it. usally  people look for protien in food well a tuna roll only has 24 grams of protein unlike our big mac and double cheeseburger have 25 grams of protein and taste better. not only this but our medium fry has more carbohydrates, we have 43 grams of  carbohydrates  and sushi has none !!! . yes there might be more calories but when ur looking for something close and near that also taste good you should go to mcdonalds

Expnation:

8 0
3 years ago
The tendency of two masses alone in the universe to<br> drift together is a result of
Vaselesa [24]
Gravity (defined as: the force that attracts a body toward the center of the earth or toward any other physical body having mass)
4 0
3 years ago
Why is sediment usually laid out in flat layers
Flura [38]
It is usually caused by the forces of gravity

Brainliest?
3 0
3 years ago
Other questions:
  • What is the most abundant organism in a food chain​
    14·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Plz help!
    12·1 answer
  • In a Hardy-Weinberg population with two alleles that show complete dominance, the frequency of the recessive allele is 0.4. What
    12·1 answer
  • What supports and strengthens the cell?
    15·1 answer
  • In figure 1, starting from the left, what magnetic poles are shown on the two bar magnets?
    9·2 answers
  • After the gram staining procedure, you realized you went too fast and have forgetten to apply the 95% ehtanol. What might be the
    7·1 answer
  • If two chromosomes of a species are the same length and have similar centromere placements and yet are not homologous, what is d
    14·1 answer
  • Describe why trasnsitioning to a hydrogen economy has advantages.<br> PLEASE HELLPPPPP
    15·2 answers
  • A biology class is studying the concept of carrying capacity. On a field trip, the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!