1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
3 years ago
15

PLS ANSWER C six H twelve O six, plus six O two, yields six C O two, plus six H two O, plus energy.

Biology
1 answer:
andriy [413]3 years ago
5 0

Answer:

Explanation:

The overall (unbalanced) chemical equation for cellular respiration is: C6H12O6+O2→CO2+H2O+energy. Explanation: The balanced equation ...

You might be interested in
Which term specifically describes the categorization of people into ethnic groups without taking into account individual differe
stira [4]

I'm pretty sure that's just Ethnicity?

7 0
2 years ago
Read 2 more answers
Why are sex-linked disorders more common in males than in females?
rewona [7]
Hmmm i think its the third one because men only have 1 x chromosome therefore without the other one if the x chromosome on a men carries a disorder it will show because there is no other chromosome to balance it out and in women the disorder has to show on both X chronosome (and its rarer) for a disorder to appear therefore women having a second X chromosome is effectively a protection
3 0
3 years ago
Which resident's information would the scientist most likely record to get valid results?
pentagon [3]
Resident 1 is to give the most valid results. 
3 0
2 years ago
HELLLLPPPPPPPPPPP HURRY
leva [86]

Answer:

A

Explanation:

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⣠⣤⣤⣤⣤⣤⣶⣦⣤⣄⡀⠀⠀⠀⠀⠀⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⠀⢀⣴⣿⡿⠛⠉⠙⠛⠛⠛⠛⠻⢿⣿⣷⣤⡀⠀⠀⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⠀⣼⣿⠋⠀⠀⠀⠀⠀⠀⠀⢀⣀⣀⠈⢻⣿⣿⡄⠀⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⣸⣿⡏⠀⠀⠀⣠⣶⣾⣿⣿⣿⠿⠿⠿⢿⣿⣿⣿⣄⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⣿⣿⠁⠀⠀⢰⣿⣿⣯⠁⠀⠀⠀⠀⠀⠀⠀⠈⠙⢿⣷⡄⠀

⠀⠀⣀⣤⣴⣶⣶⣿⡟⠀⠀⠀⢸⣿⣿⣿⣆⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⣿⣷⠀

⠀⢰⣿⡟⠋⠉⣹⣿⡇⠀⠀⠀⠘⣿⣿⣿⣿⣷⣦⣤⣤⣤⣶⣶⣶⣶⣿⣿⣿⠀

⠀⢸⣿⡇⠀⠀⣿⣿⡇⠀⠀⠀⠀⠹⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡿⠃⠀

⠀⣸⣿⡇⠀⠀⣿⣿⡇⠀⠀⠀⠀⠀⠉⠻⠿⣿⣿⣿⣿⡿⠿⠿⠛⢻⣿⡇⠀⠀

⠀⠸⣿⣧⡀⠀⣿⣿⡇⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⣿⣿⠃⠀⠀

⠀⠀⠛⢿⣿⣿⣿⣿⣇⠀⠀⠀⠀⠀⣰⣿⣿⣷⣶⣶⣶⣶⠶⠀⢠⣿⣿⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⣿⣿⠀⠀⠀⠀⠀⣿⣿⡇⠀⣽⣿⡏⠁⠀⠀⢸⣿⡇⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⣿⣿⠀⠀⠀⠀⠀⣿⣿⡇⠀⢹⣿⡆⠀⠀⠀⣸⣿⠇⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⢿⣿⣦⣄⣀⣠⣴⣿⣿⠁⠀⠈⠻⣿⣿⣿⣿⡿⠏⠀⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⠈⠛⠻⠿⠿⠿⠿⠋⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

4 0
3 years ago
The San Andreas fault is an example of which kind of boundary? A. Transform B. divergent C. oceanic D. convergent​
Leya [2.2K]

Answer:

C

Explanation:

It’s near the ocean

8 0
3 years ago
Other questions:
  • Health-insurance companies could potentially use genetic information for client discrimination if it were made publically availa
    9·2 answers
  • • cell division is the process of dividing a parent cell into two identical daughter cells. how is the process different in sexu
    11·1 answer
  • In bryophytes, which of the following structures is like a root?
    7·2 answers
  • What is a major benefit of schooling
    6·2 answers
  • Which of the following vegetables is considered a starchy vegetable?
    11·2 answers
  • A damaged stem would most likely affect what process within a plant? A) Movement of food and water between the roots and leaves.
    12·1 answer
  • Where are haploid cells<br> found?
    8·2 answers
  • During protein synthesis which molecule can be inside the nucleus and outside in the cytoplasm?
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The mass number of an atom is:
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!