1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ollegr [7]
3 years ago
13

HT217 Balancing Greenhouse Micronutrients

Biology
1 answer:
Illusion [34]3 years ago
5 0

Answer:

ann fjjg

Explanation:

You might be interested in
Explain how DNA Structure and Replication is affected by your patient’s diagnosis.
zhenek [66]
Hi miss I hope you have a good day I love you I miss your help I hope you can help me
8 0
3 years ago
The school has 800 students with 20 students on the gymnastic team and 10 students on the chess team (including 3 students who a
mr_godi [17]
This question seems like its too easy so i might have got it wrong.. but would't you just subtract 20 and 10 from 800 to get 770?
3 0
3 years ago
Read 2 more answers
The digestive system is critical to maintaining a healthy body because
masya89 [10]
The answer is D.

It is the most needed because if the waste of the body doesn't get removed then you will become very ill and possibly die.

Hope this helps! :) 
8 0
4 years ago
Read 2 more answers
What is the purpose of a conceptual model?
I am Lyosha [343]
It’s b if not then I’m wrong
4 0
2 years ago
Read 2 more answers
What determines what dreams a person has when they sleep?<br> I need help on this
ollegr [7]

Answer:

The amount of sleep people get is a huge factor in the determination of dreams a person has. Lack of sleep causes your brain to become more active than it should be at night. For example, if you hadn't had enough sleep, you're more likely to have nightmares or vividly dream.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Gene expression in all organisms depends on protein synthesis. What is the last stage in protein synthesis, in which amino acids
    8·2 answers
  • How do questions help to identify and clarify evidence
    7·1 answer
  • How many ATP are produced between all parts on this diagram?
    14·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • A 20-gram ectothermic organism and a 20-gram endothermic organism are placed together in a small, enclosed cage. The cage is hel
    11·2 answers
  • Is the study of how living things interact with each<br> other and with their environment.
    5·2 answers
  • In which part of cell does the process takes place​
    5·1 answer
  • Explain how the processes in the water cycle work together to maintain a constant amount of water on Earth.
    12·2 answers
  • How was the rotation rate of Jupiter's core determined?
    11·1 answer
  • In general, did the simulated mice align with your predictions from the Punnett squares?.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!