1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
3 years ago
6

In plants, what is the function of the xylem?

Biology
1 answer:
podryga [215]3 years ago
7 0

Answer:

Xylem is one of the two types of transport tissue in vascular plants, phloem being the other. The basic function of xylem is to transport water from roots to stems and leaves, but it also transports nutrients.

Explanation:

You might be interested in
Wildlife experts may attempt to restore the population of an individual species ?
wolverine [178]

Answer:

C

Explanation:

through captive breeding. Once they are breed, they should be released

3 0
2 years ago
Read 2 more answers
a pea plant that has round seeds has the genotype Rr. it is crossed with a pea plant that has wrinkled seeds and the genotype Rr
san4es73 [151]
50% because both are the same Genotyle dominant wise and recessive wise so it will have a fifty fifty chance of having wrinkled seeds
6 0
2 years ago
Read 2 more answers
based on hierarchical organization, place the living systems in order from smallest to largest. blue wildebeest. blue wildebeest
Sunny_sXe [5.5K]

The correct answer is:

1 - Blue wildebeest (Connochaetes taurinus)

2 - Blue wildebeests

3 - Blue wildebeests and Black wildebeests

4 - Blue wildebeests, Black wildebeests, crocodiles, acacia trees

5 - Maasai Mara

A hierarchical organization is an organizational structure where every component of the organization is subordinate to some other component.


8 0
3 years ago
What would most likely be included in the "Analysis" section of a lab report?
IgorC [24]

Complete Question:  

What would most likely be included in the “Analysis” section of a lab report?

1) a discussion of any errors in the experimental data

2) a list the supplies that were used in conducting the experiment

3) suggestions for new experiments based on the results

4) a description of what the dependent and independent variables were

Answer:

1). <u>a discussion of any errors in the experimental data</u>.

In the analysis section of the lab report, after analyzing and investigating the data, errors are identified in the experimental data. Furthermore, discussion carried out to point out those error occurred in the data. In an analysis process discussion is carried out to find the errors in the whole process. In this process all facts and figure are gather to inquire if there are any errors or mistake present in the final values or final result. Analysis section in a lab report has a key role because it make sure that the final result is error free.

8 0
3 years ago
Which Information Processing Model pillar does the scenario describe? Jack got a flat tire while driving. He did not know how to
allsm [11]
The answer to this question is :
D. Obstacle Evaluation
8 0
3 years ago
Read 2 more answers
Other questions:
  • A lawn sprinkler is a compound machine?
    15·1 answer
  • What is the main function of the ocular lens in a compound microscope
    9·1 answer
  • Living things that feed on other organisms to get energy are called _________. vegetarian producers vegan consumers
    8·1 answer
  • Haploid/gametes/sex cell number in humans is ___________
    13·1 answer
  • The U.S. Congress is in which branch of government?
    9·2 answers
  • Comparing and contrasting embryos of different species is called
    7·1 answer
  • Duchenne muscular dystrophy is a genetic disorder that arises from a recessive X-linked allele. Why is this disorder almost alwa
    15·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why does the earth have different layers?
    9·1 answer
  • WILL GIVE BRAINLIEST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!