1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
2 years ago
13

Use the following label to answer questions 11, 12 and 13.

Biology
1 answer:
Alik [6]2 years ago
4 0
1. 930 calories

310 x 3 = 930
You might be interested in
What is the answer to this question
xxTIMURxx [149]

Answer:

c

Explanation:

i guessed pic didn't load

7 0
3 years ago
Which is a disadvantage of using genetics engineering?
Mumz [18]
<span>The inserted genes may have unexpected harmful effects.</span>
6 0
3 years ago
Read 2 more answers
2.) Unlike photosynthesis, cellular respiration occurs in (1 point)
garik1379 [7]
D. Eukaryotic cells It happens in both plant and animal cells
3 0
3 years ago
Read 2 more answers
Which type symmetry applies to animals in the phylum Porifera?
Law Incorporation [45]

Answer:

A no symmetry

Explanation:

3 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • Where in eukaryotic cells does protein synthesis take place
    8·2 answers
  • Besides predators, there are other living organisms in an ecosystem that interact with a population that can cause natural selec
    15·1 answer
  • If a person has type B blood, which statement describes the antibodies present in his or her blood?
    12·2 answers
  • Which statement about viruses is correct?
    14·1 answer
  • How does a synthetic sponge mimic a live sponge to pick up dirt?
    7·2 answers
  • What change would most improve the usefulness of the graph?
    15·1 answer
  • Which grouping consists of connecting fibers that enable the cell to function as a unit?
    12·1 answer
  • What is the correct order of levels of organization, from smallest to largest?
    13·2 answers
  • What structure does annelids use?<br> (In your own words)<br> I’ll mark you as brainliest!!
    14·1 answer
  • How is an oxbow lake formed? a. An oxbow lake is formed when a lake shrinks due to erosion. B. An oxbow lake is formed when the
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!