There are different trophic levels at each stage. Trophic levels determine the amount of energy at each stage of the food chain. For example, the energy is 100% at the producer (plant), so it's the 1st trophic level, and so on. Energy amounts decrease as you go up a food chain, and you rarely find more than 5 animals in one because there is not enough energy left for the 6th consumer
To me, this sounds like the Garter Snake is becoming more immune to this toxic chemical.
Coal
Coal is a combustible black rock that is formed from prehistoric plant remains. Coal is formed from the anaerobic decomposition of dead plant matter such as trees, ferns, mosses and other marsh plants that grew on the earth surface over millions of years ago. Coal is composed largely of carbon and is usually burned as a fuel.
Answer:
The correct answer would be -
If the type of food available changes, then the frequency of beak also changes because the beak of the bird suited to food will survive successfully.
Explanation:
According to the theory of natural selection, an organism that is able to adapt according to the change in the environment, it helps in their survival and increases their number in the system.
It is given that the type of food available is changing, so it will lead to the change in the frequency of bird beaks in that particular area. So, if they adapt to survive under the changes in the available food type, otherwise not be able to survive and die.
So,
If the type of food available changes, then the frequency of beak also changes because the beak of the bird suited to food will survive successfully.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
