Answer:
They both use imagination
Explanation:
Children typically have quite a wide range of imaginative thinking, so when you are using creative thinking, you are using your imagination
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Cancer is cell replication gone wrong. It is when a cell attempts to reproduce itself, but something went wrong in the duplication of splitting process. The are connected because they are both cellular reproduction.
Answer:
This is because of the fact that it causes changes in size, shape, metabolic activities as well as signal responsiveness of cells.
Explanation:
