1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
3 years ago
7

What does archaebacteria mean?

Biology
2 answers:
laiz [17]3 years ago
6 0

Answer:

A. Ancient bacteria

Explanation:

From the salt of the earth, researchers have isolated and revived a Bacillus strain, which they believe is >250 million years old. If correct, Russell Vreeland and his colleagues from West Chester University, Pennsylvania, have discovered the oldest living organism in the world.

Delvig [45]3 years ago
3 0

Answer:

A. Ancient bacteria

Explanation:

Archae bacteria means ancient bacteria. So, option (A) is the correct answer.

You might be interested in
Use the Weather probe to measure the land-air and ocean-air temperatures. What are these temperatures at this time?
adell [148]

Answer:

Use the Weather probeto measure the land-air and ocean-air temperatures. What are these temperatures at this time? 29.1 degrees and 22.2 degrees, respectively. C.

Explanation:

3 0
3 years ago
How do sensory organs send signals to the brain?
Juli2301 [7.4K]
Sensory organs are connected to the nerves in the body which is the feeling of pain or tickle they send signals to your brain to make sure the feeling is okay is pain is what is sent your brain tells you to stop
8 0
3 years ago
What are the reactants and the products in the overall photosynthesis reaction?
adoni [48]

Answer

In photosynthesis, water, carbon dioxide, ATP, and NADPH are reactants. RuBP and oxygen are products. In photosynthesis, water and carbon dioxide are reactants. GA3P and oxygen are products.

Explanation:

7 0
3 years ago
I need help with this question?
OLEGan [10]

The need for transportation

3 0
4 years ago
Read 2 more answers
Amoeba Sisters Video Recap: Enzymes
marusya05 [52]

Answer:

<h3>Enzymes are typically which type of biomolecule?</h3>

Enzymes are protein biomolecules.

Enzymes are bound to specific substrate/s and act as <u>catalysts</u> that makes chemical reactions faster, such as breaking down lactose to smaller units of glucose, which is accomplished by lactase.

<u>Cofactors (metal ions such as iron, zinc) and coenzymes (organic molecules like vitamins)</u> may be needed to initiate chemical reactions.

<h3>Describe the effects that enzymes can have on substrates.</h3>

After creating the <u>enzyme-substrate complex</u> through <u>induced fit</u>, enzymatic products are seen after the reaction. The <u>substrates may be consumed during the process or preserved</u> to be used again.

For example, these enzymatic products may be used for feedback inhibition to control the chemical reaction and production of a certain hormone.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What happens when a piece of glass is exposed to intense heat?
    15·2 answers
  • Which tidal pattern has two high tides and two low tides each day?
    10·2 answers
  • Is a tomato a fruit?
    14·2 answers
  • What is removed to form a peptide bond between two amino acids?
    8·1 answer
  • Gravity is important not only for life on Earth, but for the makeup of the entire galaxy. Gravity holds our solar system and gal
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • USATestprep Crossword Puzzle Question:
    11·1 answer
  • Why have anoles evolved different toe pads?
    8·1 answer
  • Which gland secretes epinephrine?<br> thyroid<br> adrenal gland<br> pineal gland<br> pituitary gland
    9·1 answer
  • 1. If an organisms has a SPERM CELL with 4️⃣chromosomes. It will have____chromosomes in its SKIN CELL. *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!