1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
il63 [147K]
3 years ago
7

Genetic disorders can result when sister chromatids fail to separate properly. during which phase is this problem most likely to

occur?
Biology
1 answer:
Tanya [424]3 years ago
3 0
When all is said in done, nondisjunction can happen in any type of cell division that includes requested dissemination of chromosomal material. 
There are 3 types of nondisjunction: the disappointment of a couple of homologous chromosomes to isolate in meiosis I, a disappointment of sister chromatids to isolate amid meiosis II, and disappointment of sister chromatids to isolate amid metaphase going into anaphase of mitosis.
You might be interested in
AYUDA ES PARA HOY es de Ciencias Naturales ¿Por que a veces podemos ver la Luna de día , a veces , lo podemos ver de noche y a v
deff fn [24]

Answer:

Porque contigo yo ya escogi?

Ahora mi corazon ta supri

Bien simple lang iyo ta pidi

Era cinti tu el cosa yo ya cinti.

Explanation:

.;(

4 0
2 years ago
How many eggs are released during ovulation?
FrozenT [24]
4, but only one makes it, the rest are called polar bodies.
5 0
3 years ago
Read 2 more answers
A farmer sprays his corn crop with pesticides each year. After 10 years, he realizes that the pesticides are no longer functioni
Leokris [45]

Answer:

The pesticides are worn off by the weather.

Explanation:

Becuase the chemicals can only work for a little in the pesticides so when bad weather comes around it finishes the rest of the chemicals in the pesticide.

Hope this Helps :)

5 0
2 years ago
Read 2 more answers
Which answer is a type of muscle tissue in the human body
mash [69]

The 3 types of muscle tissue are cardiac, smooth, and skeletal. Cardiac muscle cells are located in the walls of the heart, appear striated, and are under involuntary control.

6 0
3 years ago
Can I lay down flat on the ground when a bee is chasing me?​
gayaneshka [121]

Answer:

ive never heard anything about that so i would say no

Explanation:

but if u ever get bump a bee " Remain calm and quietly move away until bees are out of sight. If bees attack, run away in a straight line and take shelter inside a car or building as soon as possible"

5 0
3 years ago
Other questions:
  • Adapted from images courtesy of NIH and Wikipedia.
    9·2 answers
  • #1. Which of the following structures would you expect to find in a single-celled organism? A. internal organs B. legs and feet
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • In which of the following ways are tRNA and mRNA different?
    7·2 answers
  • Vascular plants, like fern, show alternation of generations. Which represents a gametophyte in the life cycle of fern? a. Rhizom
    11·1 answer
  • With the following crosses of pea plants, give the flower color of offspring and the ratio expected (red is dominant).. . A cros
    5·2 answers
  • During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a replication fork. 2. Ok
    11·1 answer
  • Which functional group is below in red
    15·1 answer
  • What type of transport happens when a substance moves from an area
    6·1 answer
  • Fatty acids are catabolized through which process?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!