1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
2 years ago
8

Which statement describes Newton’s discovery about gravitational force?

Biology
1 answer:
AfilCa [17]2 years ago
7 0
A. Mass creates a force that can create additional mass
You might be interested in
One of the problems with the trichromatic theory of color vision is that it cannot explain why negative afterimages (i.e., after
Iteru [2.4K]
The principle of ruling in critical thinking that this reminds us to consider is the ruling principle. Critical thinking is the objective analysis of facts to form a judgement. Based on Ruling out Rival Hypotheses; findings consistent with several hypotheses require additional research to eliminate these hypotheses. 
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
which of the following is not a characteristic of Arthropods that has attributed to their diversity and success A. endoskeleton
ValentinkaMS [17]
A. endoskeleton

Endoskeleton is not a characteristic of Arthropods that has attributed to their diversity and success. Endoskeleton is defined as inner characteristics of the skeletal feature of an organisms such as bears, humans, fish and etc.

Exoskeleton on the other hand is the trait by which arthropods posses. It is skeletal feature that is described outside or is extrinsic, this is evident as crabs have their skeletons outside of their body.


6 0
2 years ago
The notable hardness of bone is attributed to ________. the notable hardness of bone is attributed to ________. the presence of
Sloan [31]

 The notable hardness of bone is attributed to the presence of inorganic hydroxyapatites. Due to the calcium salts deposited in it, resulting to the hardness. The abnormal hardness of bone, which allows it to resist the compression.

6 0
3 years ago
Bacteria that is jagged and random is called what?
Burka [1]
It is called jagged gaphene i think
6 0
3 years ago
Other questions:
  • ________ believed that use (or lack of use) of body parts enables individual to develop certain traits that it passes on to its
    8·1 answer
  • Select all that apply. Ground water pollution can be caused by _____. chemical spills road salt pesticides fertilizers
    10·2 answers
  • Organisms at the first trophic level in a food pyramid are:
    7·1 answer
  • 6. the part of the circulatory system that brings carbon-dioxide filled blood to the lungs cell
    13·1 answer
  • Organisms get half of their ____From their mothers
    9·1 answer
  • Discuss the meaning and significance of the fact that the<br> genetic code is degenerate.
    8·1 answer
  • Type the correct answer in the box. Spell all words correctly,
    7·1 answer
  • Consumer programs perform which two of the following functions to protect consumers?
    5·1 answer
  • Which pollution type resulted in the most hypoxic waters? Support this with evidence from your data.
    10·1 answer
  • Definition of group in science.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!