1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
diamong [38]
3 years ago
9

1 point

Biology
1 answer:
shutvik [7]3 years ago
4 0

Explanation:

photosynthesis eats carbon dioide cellaur doesnt

You might be interested in
What type of rock forms when magma cools?
zhuklara [117]
Cercel ben Türkçe biliyorum İngilizce ama ben de seni çok seviyorum seni çok teşekkür ederim canım ben Türkçe konuşuyorum o zaman sen daha açıklayıcı oldu teşekkür ederim canı
What type of rock forms when magma cools?
A. Limestone
B. Metamorphic
C. Sedimentary
D. Igneous
m
8 0
3 years ago
Read 2 more answers
Boreal owls range over a much larger area than do other owls of similar size. The reason for this behavior is probably that the
Sonbull [250]

Answer:

(B) Boreal owls range over larger areas in regions where food of the sort eaten by small mammals is sparse than they do in regions where such food is abundant

Explanation:

Living beings exhibit various changes in the behavior and niche to make themselves better fitted to the conditions of their habitats.  

Boreal owls feed on the other smaller mammals such as mice and shrews. These organisms that serve as their prey are relatively less abundant in the habitat. To ensure the food availability, the boreal owls occupy a larger area so that they can catch their less abundant food organisms.  

In the habitats where the prey species of boreal owls are present in a larger number, these owls occupy smaller regions since the food organisms are easily available.  

7 0
3 years ago
In the hypothesis that C. stellatus (a species of barnacle) is competitively excluded from the lower intertidal zone by B. balan
lord [1]
<h2>Competitive exclusion principle.</h2>

Explanation:

The fundamental and realized niches of B. balanoides are identical, but the fundamental and realized niches of C. stellatus are different.

All the possible combination of resources and condition under which a species can grow, survive and reproduce is called its fundamental niche. Whereas, the more limited set of resources and condition under which a species can grow, survive and reproduce in the presence of competitors and predators is termed as its realized niche.

Competitive exclusion principle states that if two competing species coexist in a stable, homogeneous environment, then they do so as a result of differentiation in their realized niche.

<em>B. balanoides</em> can use a wider range of resources than<em> C. stellatus </em>because its fundamental and realized niches are identical . Hence thrives to exclude C.stellatus.

4 0
3 years ago
What three cellular structures are found in plant cells but not animal cells?
sergeinik [125]
C! Because animal cells don’t have a cell wall! Have fun in Science!
5 0
3 years ago
As blood glucose returns to its baseline level, what happens to the levels of insulin and glucagon in the blood
Otrada [13]
As blood glucose returns to its baseline level, the levels of insulin and glucagon in the blood will stabilize. As the blood glucose levels begin to drop below the base line, the concentration of glucagon hormone increases.  while as the blood sugar levels increases above the baseline, the level of insulin hormones increases. Insulin and glucagon work antagonistically to maintain the normal level of glucose in the blood. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • Although computer chips are partly made of crystals manufactured in a factory by humans, why is it that these chips cannot be ca
    10·1 answer
  • Hypodermic needles frighten Janice. As she awaits a flu shot, Janice's _____ nervous system is probably going into overdrive as
    8·1 answer
  • Helppppppppppppppppppppppppppppppp
    8·1 answer
  • Different chemical elements will create a different scattering of absorption lines in the spectrum of visible light. We understa
    10·1 answer
  • What are the two main divisions of the nervous system
    9·2 answers
  • Hypothesis Practice which Oreo cookies filling do you think the class would like the best chocolate, vanilla creme or peanut but
    8·1 answer
  • What are all the plant only cells
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What are the genetics chromosomes for male and female? Female<br> Male<br> XY<br> XX
    15·2 answers
  • Please help me <br>is for my daughter ​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!