1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leokris [45]
3 years ago
6

Give two examples of the processes that form soil over long periods of time.

Biology
2 answers:
Igoryamba3 years ago
6 0
Soil forms as a result of weathering and biological activity that breaks down and changes soil materials over long periods of time.
saul85 [17]3 years ago
6 0

Answer:(1) slow chemical alteration by water seeping through the weathered rock material after rains and (2) mixing of the rock material with organic debris produced by the decay of plants.

Explanation:

You might be interested in
In order to be considered work, the components that must be present are (2 points)
Nikolay [14]
Force and displacement must be present according to formula and if asking about components then maybe X and Y
8 0
4 years ago
Which is the best description for why skeletal muscle stores glycogen
gayaneshka [121]

Answer: Skeletal muscle is a heavy consumer of energy.

3 0
3 years ago
How quickly does the process of excretion occur in plants?
beks73 [17]

Explanation:

Plants produce two gaseous waste products i.e. oxygen during photosynthesis and carbon dioxide during respiration. Excretion of gaseous waste in plants takes place through stomatal pores on leaves. ... Excess of water is also excreted from the plant body through the stomatal pores and from the surfaces of fruits and stems.

5 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Which best describes the brain stem?
zepelin [54]
The answer is C. The brain stem controls blood circulation.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Root vegetables, such as carrots, are classified as what type of root system?
    11·2 answers
  • Explain the purpose of the placenta and describe how a fetus gets its nutrients.
    9·1 answer
  • What is happening to jim's blood glucose levels just before the race?
    8·2 answers
  • Which of the following are part of the chemiosmotic coupling model? Protons are pumped out of the mitochondrial matrix into the
    10·1 answer
  • Which of these is NOT an option to help increase sustainability?
    11·1 answer
  • What is a major benefit of schooling
    6·2 answers
  • How is salinity measured
    15·2 answers
  • Short-term mechanisms for regulating blood pressure include regulating peripheral vascular resistance and cardiac output through
    9·1 answer
  • Help on bio test........
    11·1 answer
  • Someone pls help me with this, bcs i really dont know what’s happening, as im new to Biology
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!