1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gogolik [260]
2 years ago
11

Using the Dichotomous Key, Identify the RED organism.

Biology
1 answer:
sveticcg [70]2 years ago
3 0

Answer:

Alienus Hairicus

Explanation:

Followed all direction and it brought me to this answer!

<h3>Hope this Helps!</h3>

:)

You might be interested in
Which part of the wave is changed when there is interference?
Mamont248 [21]

Answer:

the amplitude.

Explanation:

The reason why is because an interference is when 2 waves combine to form a wave with a smaller amplitude than either the original wave...It occurs when the crest of one waves overlapes the trough of another wave

8 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
If the two traits that Mendel looked at in his dihybrid cross of smooth yellow peas with wrinkled green peas had been controlled
nalin [4]

Answer:

c. Would have deviated from the 9:3:3:1 phenotypic ratio

Explanation:

<em>If two genes are linked together on the same chromosome, the phenotype of the F2 generation would have deviated from 9:3:3:1.</em>

Two genes whose loci are close on the same chromosome are said to be linked. Linked genes have higher frequency of recombination than genes that are not linked.

<u>Hence, while genes that are not linked assort independently to produce 9:3:3:1 phenotypic ratio at F2, linked genes do not assort independently and the higher frequency of recombination ensures that they standard phenotypic ratio is deviated from.</u>

The correct option is c.

3 0
3 years ago
What are the characteristics of the vertebrate's nervous systems?
Delicious77 [7]

Answer:

Vertebrates contain nervous system which is highly specialized organ.

Explanation:

The nervous system is the complex system in the vertebrate body which is composed of central nervous system that contain brain,spinal cord and peripheral nervous system which contain cranial nerve, spinal nerve,involuntary nerve etc.

The nervous system contain neurons that mainly transmit signal to the different parts of the body.

The peripheral nervous sytem contain somatic and visceral part.

The grey matter and white matter are the 2 areas in vertebrate nervous system.

6 0
3 years ago
What happens when stimulus vanishes from a contracted muscle?
baherus [9]

Answer:

When a muscle contracts, the actin is pulled along myosin toward the center of the sarcomere until the actin and myosin filaments are completely overlapped.

Explanation:

Is this the answer you're looking for?

4 0
3 years ago
Other questions:
  • 2 Points
    15·1 answer
  • What is the function of a muscle to the structure of the skin
    5·1 answer
  • How do you call a balance in which the rate of change in one direction is equal to the rate of change in another?
    6·1 answer
  • Typical fatty acids cannot be converted to glucose because ______________.
    12·1 answer
  • Is an environment in which an organism's needs are met.​
    6·2 answers
  • Introns are deleted before a gene is transcribed from DNA to mRNA?
    14·1 answer
  • Plz plz plz help asap
    7·1 answer
  • What is the source of the carbon dioxide that is used in photosynthesis?
    8·2 answers
  • How do chloroplasts capture energy from the sun worksheet answers.
    5·1 answer
  • Where does frontal inversion occur in the atmosphere and how does it affect us and the environment? Wanther High
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!