1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
15

Fill in the Blank

Biology
2 answers:
padilas [110]3 years ago
7 0
First is information
Alex787 [66]3 years ago
3 0

The first one is <u>e-commerce</u>.

The second one is <u>heat</u>.

Internet technology is used to provide  e-commerce sites that allow fashion designers to sell their products.

When the body starts to cool, this causes phase change materials in clothing to release  heat back to the body.

<em>The assignment on Edg states:</em>

<em>-"Some fashion designers create sketches by hand while many use computer-aided design programs (CADs). Another benefit of STEM, CAD programs allow designers to view their designs on virtual models. They can also view different shapes, designs, and colors all from their computers. In general, it takes about six months for the complete design process, from initial design to final product. </em><em><u>Besides selling their designs in stores, many fashion designers use </u></em><em><u>e-commerce</u></em><em><u> and the Internet to sell their products.</u></em><em>"</em>

<em />

<em>-"Outlast Adaptive Comfort products create temperature-regulating textiles. Outlast technology uses phase change materials (PCM) that collect and store excess heat from the body. </em><em><u>When the body cools, the material then releases </u></em><em><u>heat</u></em><em><u> back to the body for optimal thermal comfort.</u></em><em> This material can be incorporated into fibers and fabrics. With a material such as that, heavy coats and winter-wear clothing may not be needed!"</em>

You might be interested in
What is an example of competition among members of a meerkat population?
Diano4ka-milaya [45]
Be more specific plz male or female?
5 0
3 years ago
A cross between two pea plants, both of which grew from yellow round seeds, gave the following numbers of seeds: 156 yellow roun
LiRa [457]

Answer: The correct answer would be YYRr and Y_Rr

Explanation:

Let us denote Y and y be the alleles of the gene responsible for seed color and R and r be the alleles of the gene responsible for seed shape. Capital letter is for dominant allele and small letter is for recessive allele.

Being dominant traits, both the parents should have at least one dominant allele of both the genes. It is because the phenotype of both parents is yellow and round seeds.

In addition, F1 shows single phenotype for seed color but both phenotype for seed shape. The presence of recessive phenotype in F1 indicates that both the parents must be heterozygous for seed shape, that is, Rr.

However, for seed color, it is possible that either one or both were homozygous, that is, either both YY or one parent is YY and another parent is Yy.

7 0
4 years ago
Last question i need answered. thank you all for those who helped me
Sedbober [7]

Answer:

the large mouth bass and the wood duck

6 0
3 years ago
How could newborns be infected with this bacterium that is normally found in the soil, water, and feces?
Ugo [173]
Answer: It can affect the baby because Listeriosis is caused by the bacteria in soil the name of it is Listeria monocytogenes. The disease can survive in soil for many months just like bacteria... Babies can become infected in utero or at birth.
7 0
3 years ago
El Niño causes excessive rains in the Midwestern United States. These rains lead to flooding across the region. Which effects ar
levacccp [35]

Answer:

A. Population loss of small animals

B. Forced migration of some populations

E. Loss of habitat

Explanation:

4 0
4 years ago
Other questions:
  • Lichens, represented by this symbiotic relationship, are responsible for _____________ or the establishment of a new site for pl
    7·1 answer
  • As rescuers in a population becomes less available.the population
    10·1 answer
  • This can contribute to desert formation:
    5·2 answers
  • Which of the following rocks would form from lava following a volcanic eruption?
    11·1 answer
  • Once an embryo forms, homeostasis is maintained by the _____
    7·2 answers
  • 1. What process happens in the mitochondria?
    9·1 answer
  • 6. ¿Cuál de las siguientes moléculas está formada por
    8·1 answer
  • What kind of energy does food provide for living things? ​
    14·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Why are white-eyed female fruit flies so rare in nature?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!