1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margarita [4]
1 year ago
10

Why are white-eyed female fruit flies so rare in nature?

Biology
1 answer:
frozen [14]1 year ago
8 0
I believe the answer is b sorry if I’m wrong
You might be interested in
Name 3 reasons why glucose is needed
Delicious77 [7]
It serves as energy for the body the cells it helps carry out nerve ceel conduction muscle cell contraction, active transport and the production of chemical substances.
8 0
3 years ago
Mikah is creating a poster for her science class to illustrate the major factors responsible for reducing the amount of global b
Travka [436]
D is the answer man.
7 0
2 years ago
PLEASE HELP MEEEEE!!!!!!!!!!!!!! If 1 kg of fuel is used in the above fusion reaction, the resulting helium has a mass of 0.993
masya89 [10]

Answer:

mass using E= mc^2  is = 0.007*(3E8)^2 = 6.3E14 Joules

Explanation:

hope this helps :)

8 0
2 years ago
SCIENCE HELP!!!
valentina_108 [34]
1.) Charring a Marshmallow

2.) I think its B 
5 0
3 years ago
Read 2 more answers
The table shows the energy that is stored in three types of organic molecules. What is the best conclusion based on this data?
Alina [70]

The answer is B hope this helps : )

3 0
2 years ago
Other questions:
  • Which is usually colder, A deep current or a surface current.....PLEASE HELP
    8·2 answers
  • whathefuk jjjfhfhrhfhrhfhfhfhffhfhfhfhfhfh jfk airport in roBLOX HENTI WYEBHWSNFAJKW26TWHWBW WTWHW EQWTWHW WTQWTWNW WTHDFF QTWH
    14·2 answers
  • Fossils help scientists classify extinct species and determine their relationship to current species. Fossils provides What info
    5·1 answer
  • Which type of soil can retain the greatest amount of water?
    9·1 answer
  • All instructions for formatting characteristics (proteins)are carried on ...
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • A city is most likely to experience a change in weather under which of the following conditions?
    8·1 answer
  • During the mitotic phase first the nucleus then the cytoplasm divide<br><br> true<br><br> false
    7·2 answers
  • Which of the following is an example of a prokaryote?
    5·2 answers
  • Enter an algebraic equation for the word sentence. Use x as your variable.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!