1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guajiro [1.7K]
3 years ago
12

Find the mean and median of these data: 2, 4, 10, 12, 18, 20.

Mathematics
1 answer:
UNO [17]3 years ago
3 0
The mean of this data is: 11

The median of this data is: 11

The mean and median of this data is the same in this case.
Hope this helps
Have a great day :)
You might be interested in
Please answer correctly !!!!! Will mark Brianliest !!!!!!!!!!!!!!
ELEN [110]

Answer:

Volume~of~cylinder=\pi r^2h

  • \pi *(10)^2*5
  • 500\pi
  • 1570.8~m^3

<u>-------------------------</u>

<u>hope it helps..</u>

<u>have a great day!!</u>

3 0
3 years ago
Read 2 more answers
HELPpppp MeeeeE PLZ!!!!!!!!
Art [367]

Answer:

answer is a

Step-by-step explanation:

7 0
3 years ago
Answer Yes or No and explain why in one sentence.<br>(click the picture)
Lilit [14]
Yes, because there are common factors in the equation. therefore showing you can group
8 0
3 years ago
Read 2 more answers
Read the following and answer the questions that follow.
user100 [1]

Answer:

Step-by-step explanation:

(7/12) of 840 attended the concert:

(7/12)*(840) = 490 students attended the Spring Concert.

(840 - 490) = 350 did not attend

(350/840) is the fraction of students who did not attend.  This can be reduced to (35/84)

(350/840) = 0.4167 or 41.67% did not attend.  

3 0
2 years ago
The school is having a dance as a fundraiser. Tickets cost $. Each
Art [367]

Answer:

How are we supposed to know .???

we can only see half of the problem

Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Question 3: Solve the Variables<br> Will give brainliest, must show work and answers!
    5·1 answer
  • 2.5 Refer to Exercise 2.4. Use the identities A = A ∩ S and S = B ∪ B and a distributive law to prove that a A=(A∩B)∪(A∩B). b If
    12·1 answer
  • Vladimir buys 1.20 pounds of Skittles, 7.2 pounds of M&amp;Ms, and 5.2 pounds of pretzels. If the candy cost $1.20 a pound and t
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • In order to get a certain shade of blue paint, a mixer must have 5 parts white paint to 3 parts blue. If 4 gallons of paint must
    12·2 answers
  • The polynomial function 1x) = 5x^5+16/5x-3
    14·1 answer
  • GIVNING BRAINLIST
    11·1 answer
  • Solve the following sub 1) find the value of p,ifp +5=3
    12·1 answer
  • (6x + 1)(5x + 8) help please
    12·2 answers
  • Jeans cost $38. They are on sale for 45% off. What is the sale price?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!