1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lorasvet [3.4K]
2 years ago
6

Are fibrous proteins heavier than globular proteins in terms of molecular weight? Why?

Biology
1 answer:
quester [9]2 years ago
3 0

Answer:

Proteins range in molecular weight from 1000 to more than 1 million daltons (Da), but the folded size of a globular protein is not necessary correlated to its molecular weight. Proteins composed of about 250 amino acids or less often have a simple, compact globular shape. Larger globular proteins are usually made up of two or more recognizable and distinct structures, termed domains or modules. These are compact, folded protein structures that are usually stable by themselves in aqueous solution. Typical domain structures consist of hydrophobic cores with hydrophilic surfaces. Individual domains often possess unique functional behaviors and often perform unique functions within the larger protein in which they are found.

You might be interested in
Which phenomenon occurs when the sun crosses the plane of earth's equator​
Evgen [1.6K]

The phenomenon is called an equinox. More specifically when it is September it is called the autumnal equinox ,and when it is March it is called the vernal equinox.  Hope this helped!

6 0
3 years ago
Three generations of a family afflicted with hemophilia are illustrated in the pedigree chart family members used the pedigree c
nasty-shy [4]
For the given situation above, I'm afraid I cannot answer your question since a pedigree chart isn't provided along with the question. You can resubmit your question together with the chart and we'll analyze it. Thank you for posting though. Here is what pedigree analysis is about.

Scientists have devised an approach, called pedigree analysis<span>, to study the inheritance of genes in humans. Pedigree analysis is also useful when studying any population when progeny data from several generations is limited. Pedigree analysis is also useful when studying species with a long generation time.</span>
4 0
2 years ago
Read 2 more answers
Malaysia is a country which is rich with wide biodiversity of natural resources. Various methods are
Lerok [7]

Answer:

Malaysia is a beautiful country and rich in biodiversity of natural resources. People in Malaysia take several steps to protects its biodiversity and it is one of the beautiful tourism spot as well. If no steps are taken to  protect the species, there may be following effects:

  • Loss of biodiversity and species can become endangered or extinct.
  • Can lead to environmental disasters due to imbalance in biodiversity.
  • Habitat loss of plants and animals.
  • Climate can change due to ecosystem instability.
  • Tourism will reduce in Malaysia that can affect it economically as well.

6 0
2 years ago
The movement of water in a natural channel such as a creek, stream or river is known as which of the following?
marta [7]
Stream flow is your answer
4 0
3 years ago
The smallest possible part of the element calcium is a calcium ??
erastovalidia [21]
FALSE, Atom

An atom is the smallest particle of an element, having the same chemical properties as the bulk element.
4 0
2 years ago
Read 2 more answers
Other questions:
  • A sample of DNA reveals 30.3% Adenine. How much Guanine is present?
    10·1 answer
  • What is s Dromedario?
    7·1 answer
  • Which statement about the pancreas is not true?
    14·1 answer
  • A population can decrease due to deaths or ________?
    5·1 answer
  • According to ohmz law which is stated as I = V ÷ R which two sentences are true ?​
    9·1 answer
  • Entre una planta alta de color purpura (AABB) con otras planta enana de color blanco (aabb), ¿cómo será el genotipo y el fenotip
    14·1 answer
  • Only around 1.5% of human DNA is used to make proteins, meaning<br> only 1.5% of human DNA
    5·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Particles of the ground that have a lot of energy can do two different things with this energy. What are these two things?
    14·1 answer
  • Match each inference about Barrow boy with the clue that best supports it.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!