AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Genetics is the study of how heritable traits are transmitted from parents to offspring. Humans have long observed that traits tend to be similar in families. It wasn't until the mid-nineteenth century that larger implications of genetic inheritance began to be studied scientifically.
Explanation:
Answer:
c. There is uncontrolled cell division.
Explanation:
There is uncontrolled cell division that result in the improper functioning of a checkpoint protein in a cancer cell because checkpoint protein monitors and control the the process of cell cycle. If mutation occurs in this checkpoint protein, the cycle is no longer in control which leads to the uncontrolled cell division and we also know that cancer is a disease which occurs due to uncontrolled division of the cell.
Hey there!
Your answer: Available Space
The question is asking, which of the following options would be a (limited source). We have to find a option that has a limited source, which means that there is a limit to something. Your answer is (b) because there are limited space with the spce that is already available. Air temperature would NOT be your answer.
