1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
3 years ago
7

Please help, online school is sucking rn :(

Biology
1 answer:
gayaneshka [121]3 years ago
3 0
I feel you the first one
You might be interested in
3. The diagram below represents the organizational levels of living things. Which of the following examples represents an exampl
Paladinen [302]

Answer:

im,not for sure but I think it's B

Explanation:

Add the diagram to your question and I can probably get it for sure

3 0
3 years ago
Read 2 more answers
Plzz help!!!
Tom [10]
A , a different form of DNA containing
8 0
3 years ago
Read 2 more answers
What is the source and sink for xylem and phloem?
Strike441 [17]

Answer:

Sap moves through phloem via translocation, the transport of dissolved materials in a plant. Unlike the xylem, which can only carry water upward, phloem carries sap upward and downward, from sugar sources to sugar sinks: Sugar sources are plant organs such as leaves that produce sugars

8 0
4 years ago
What type of isolation needs to occur for speciation to happen?
natita [175]
"REPRODUCTIVE ISOLATION" needs to occur for speciation to happen.....
8 0
3 years ago
Which are scentific questions that can be asked about a collection of diffrent ochid types?
patriot [66]

Answer:

Do different colors attract different pollinators.

Explanation:

5 0
4 years ago
Other questions:
  • Which organelle is most like a factory delivery driver?
    10·2 answers
  • When using a​ bag-mask device, the proper ventilation rate for a child with a pulse​ is:?
    14·1 answer
  • Which indicators are living and non-living?
    15·1 answer
  • PLEASE HELP!!! A small population of crocodiles lives in an isolated area the undergoes no changes for a long period. How will g
    13·2 answers
  • If you stir salt into boiling water, your produce a
    11·1 answer
  • Why do you think it is important for a cell to grow before it replicates its DNA? Be as specific as you can in your answer
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 4) Aos poucos, as pessoas estão aderindo às lâmpadas de LED que são mais eficientes, pois
    7·1 answer
  • I’ll give you brainliest pls this is due tmr!!
    7·2 answers
  • Help ASAP, I need the right answer please.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!