All categories

3 years ago

Can you show the work for 444*31

Mathematics

1 answer:

marusya05 [52]3 years ago

4 0

Keep multiplying the number by 31, and write that down to show ur work

You might be interested in

X/9 - 1 = 2 solve for x

Eddi Din [679]

Answer: x=27

Step-by-step explanation:

8 0

3 years ago

Please answer question now

Eva8 [605]

Answer:

MN = 3

Step-by-step explanation:

The following are congruent to each other as each pair are tangents of a circle drawn from the same external point:

PQ = QJ = 1

JK = KL = 4 - 1 = 3

MN = ML

Thus, ML = KM - KL

ML = 6 - 3 = 3

Therefore, MN = ML = 3 (both are tangents drawn from the same external point, M.

5 0

4 years ago

What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA

Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0

3 years ago

Read 2 more answers

The arena set-up team’s work schedule is shown in the table below. Convert the minutes worked into hours.

Sladkaya [172]

Answer:

$Mike\ Chewer = 14\frac{1}{2}\ hr$

$Jennifer\ Glass = 3\frac{3}{4}\ hr$

$Fred\ Carlton = 1\frac{1}{4}\ hr$

$Amy\ Amaretto = 12\ hr$

Step-by-step explanation:

Given

$Mike\ Chewer = 870\ minutes$

$Jennifer\ Glass = 225\ minutes$

$Fred\ Carlton = 75\ minutes\\$

$Amy\ Amaretto = 720\ minutes$

Required

Convert to hours (in fraction)

To do this, we simply divide the time by 60

$Mike\ Chewer = 870\ minutes$

Divide by 60

$Mike\ Chewer = \frac{870}{60}\ hr$

$Mike\ Chewer = \frac{87}{6}\ hr$

Express as mixed numbers

$Mike\ Chewer = 14\frac{3}{6}\ hr$

Simplify

$Mike\ Chewer = 14\frac{1}{2}\ hr$

$Jennifer\ Glass = 225\ minutes$

Divide by 60

$Jennifer\ Glass = \frac{225}{60}\ hr$

Express as mixed numbers

$Jennifer\ Glass = 3\frac{45}{60}\ hr$

Simplify

$Jennifer\ Glass = 3\frac{3}{4}\ hr$

$Fred\ Carlton = 75\ minutes\\$

Divide by 60

$Fred\ Carlton = \frac{75}{60}\ hr$

Express as mixed numbers

$Fred\ Carlton = 1\frac{15}{60}\ hr$

Simplify

$Fred\ Carlton = 1\frac{1}{4}\ hr$

$Amy\ Amaretto = 720\ minutes$

Divide by 60

$Amy\ Amaretto = \frac{720}{60}\ hr$

$Amy\ Amaretto = 12\ hr$

3 0

3 years ago

Someone please help me answer this question

Rasek [7]

Answer:

reeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee

Step-by-step explanation:

5 0

3 years ago

Read 2 more answers