Answer:
Chromosomes contain the recipe for making a living thing. They are found in almost every cell's nucleus and are made from strands of DNA (oligonucleotide acid). Segments of DNA called "genes" are the ingredients. Each gene adds a specific protein to the recipe.
Explanation:
wedsite
Answer:
agriculture can cause problems such as less housing, cut down of trees to make way for more agricultural things and the animals causes more droughts. But it helps give people food
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
The answer to this question is C
