1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
12

Mendel started his studies with parent pea plants that had specific genotypes. What are the terms that are used to describe EACH

of the two plants that Mendel used in the P generation?
One parent plant had a __________________________________ genotype.

One parent plant had a _____________________________________ genotype.
Biology
1 answer:
Ugo [173]3 years ago
7 0
Plants used in first-generation crosses were called P, or parental generation, plants.Mendel collected the seeds produced by the P plants that resulted from each cross and grew them the following season. These offspring were called the F1, or the first filial (filial = daughter or son), generation.
You might be interested in
Help Me Please!!! ASAP
GREYUIT [131]

Answer:

Chloroplasts.

Light-dependent reactions occur in the thylakoid membranes. The light-independent reactions occur in the stroma of the chloroplasts.

Hope that helps

4 0
3 years ago
This is a geologic event that occurs when tectonic plates are shifted violently.
SCORPION-xisa [38]

Earthquake should be the answer. When tectonic plates are shifted it causes an earthquake.

3 0
3 years ago
Please help me answer the questions!!!:)
kupik [55]
The top 5 are easy loooooookkkkkk on the map D is de pere
7 0
3 years ago
Which scatterplots have clusters? Check all that apply.
slavikrds [6]

Answer:

On a graph, points are grouped closely together.

I only put one answer because the choices repeat.

6 0
3 years ago
Read 2 more answers
You decide to create a composting bin for your house. While checking on it one day, you notice that the compost bin has started
dalvyx [7]

Answer:

Turning the pile to aerate the compost and expose it to oxygen will help resolve the smell

4 0
3 years ago
Other questions:
  • Essential amino acids cannot be produced by the body, so they must come from our diet. We can get them from eating foods that co
    5·1 answer
  • A female client arrives at the clinic reporting fatigue that is exhausting, bruising on the skin, and bleeding from the gums. Wh
    7·1 answer
  • An SDS lysate of red blood cells was submitted to SDS polyacrylamide gel electrophoresis. The sample revealed a major band with
    12·1 answer
  • What is a symptom of bacterial pharyngitis? symptoms have a gradual onset rhinitis fever wbc in normal range?
    6·1 answer
  • Which statement best describes the relationship between heat and temperature?
    11·1 answer
  • A student found a grasshopper in their backyard and wanted to take it to school to show the teacher the next day. The student pu
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Does Chlorine by gaining an electron becomes chorine ion with a symbol Cl​
    9·1 answer
  • Please hellllpppp!!!! Pleaseee!
    6·1 answer
  • Freshwater wetlands can be found _______. A. Along freshwater lakes b. In the lower regions of rivers c. In a range of climates
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!