1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BlackZzzverrR [31]
3 years ago
11

One of the primary functions of RNA molecules is to _____. One of the primary functions of RNA molecules is to _____. act as a p

attern or blueprint to form DNA function in the synthesis of proteins transmit genetic information to offspring form the genes of higher organisms make a copy of itself, thus ensuring genetic continuity
Biology
1 answer:
nadya68 [22]3 years ago
7 0

Answer: function in the synthesis of proteins

Explanation:

Ribonucleic acid or RNA is a kind of essential nucleic acid present in the cells of the living beings. The main function of the RNA is to carry the information present in the coded form in amino acid sequence obtain from the genes to produce protein molecules. The amino acid sequence gets assembled on the ribosome brought about by the messenger RNA (mRNA) each amino acid sequence encodes for a typical protein molecule. A single strand of DNA acts as a blueprint for the synthesis of mRNA which is transcribed from the strand of DNA.

You might be interested in
Which is a shared characteristic of all animals?
Molodets [167]
They are all eukaryotic orgabisns, have a wild nature, they all have a niche, etc.
6 0
3 years ago
Read 2 more answers
Type the correct answer in the box. Spell all words correctly.
Anit [1.1K]

Henry Faulds and Galton are cousins which both helped each other like Faulds wrote a book about fingerprints which helped Galton out a lot.

Faulds was also the Father of Fingerprinting.

hope i helped ~Zuzu :)

7 0
2 years ago
Read 2 more answers
20 POINTS!!!!!!
ladessa [460]

Yes, Both Cells are Living

According to Cell Theory,

Any thing is Called A "Living Organism" When it Contain 1 pr More Cells

Both Cells Are Able to Produce Their own Energy

Hence, Both are Said Living

4 0
3 years ago
Read 2 more answers
Transcribe the following DNA into mRNA<br><br> T-A-C-C-G-T
Alina [70]

A-U-G-G-C-A

G matches w/ C

T matches w/ A but when transcribing to mRNA instead of T its U

4 0
2 years ago
The reason water sticks to the inside of a graduated cylinder like the image below is because of _____. Meniscus Select one: a.
chubhunter [2.5K]
A: adhesion 
if it help u plz pick as best tnx
5 0
3 years ago
Other questions:
  • What is the difference between glycolysis and the Krebs cycle?
    5·1 answer
  • The grid-like lattice of proteins that gives the cell shape and support is the __________________. endoplasmic reticulum cytosol
    6·2 answers
  • Sodium and potassium ions are essential for muscle contractions of the heart. The ions are transported using a pump, which obtai
    5·1 answer
  • At approximately what TIMES did the glucose level spike in this person?
    15·1 answer
  • You are a biologist on a trip to an island in the south pacific. while on the island, you are allowed to collect dna samples fro
    11·1 answer
  • A steady activity in which your heart supplies oxygen to help fuel your muscles is
    5·1 answer
  • A mutation that has risen to high frequency through a selective sweep shows a characteristic pattern in which only one allele is
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What do the chromosome pairs do in<br> meiosis?
    15·1 answer
  • Suppose humans accidentally introduced a non-native species to a can of warriors bird to the region if these birds feeder school
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!